ID: 1028727063

View in Genome Browser
Species Human (GRCh38)
Location 7:94100209-94100231
Sequence ATGTGAGTATGTAGGAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028727060_1028727063 0 Left 1028727060 7:94100186-94100208 CCAATTTTCTCATGCTCTCTTTT No data
Right 1028727063 7:94100209-94100231 ATGTGAGTATGTAGGAAAATGGG No data
1028727059_1028727063 12 Left 1028727059 7:94100174-94100196 CCTCAAATTACTCCAATTTTCTC No data
Right 1028727063 7:94100209-94100231 ATGTGAGTATGTAGGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028727063 Original CRISPR ATGTGAGTATGTAGGAAAAT GGG Intergenic
No off target data available for this crispr