ID: 1028728946

View in Genome Browser
Species Human (GRCh38)
Location 7:94122644-94122666
Sequence GAGACTTTGAGCGGGCATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028728946_1028728953 18 Left 1028728946 7:94122644-94122666 CCCTAATGCCCGCTCAAAGTCTC No data
Right 1028728953 7:94122685-94122707 AGAGAACCAGTGGGGTATTGTGG No data
1028728946_1028728951 9 Left 1028728946 7:94122644-94122666 CCCTAATGCCCGCTCAAAGTCTC No data
Right 1028728951 7:94122676-94122698 AATTTGAAAAGAGAACCAGTGGG No data
1028728946_1028728950 8 Left 1028728946 7:94122644-94122666 CCCTAATGCCCGCTCAAAGTCTC No data
Right 1028728950 7:94122675-94122697 TAATTTGAAAAGAGAACCAGTGG No data
1028728946_1028728952 10 Left 1028728946 7:94122644-94122666 CCCTAATGCCCGCTCAAAGTCTC No data
Right 1028728952 7:94122677-94122699 ATTTGAAAAGAGAACCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028728946 Original CRISPR GAGACTTTGAGCGGGCATTA GGG (reversed) Intergenic