ID: 1028728947

View in Genome Browser
Species Human (GRCh38)
Location 7:94122645-94122667
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028728947_1028728955 30 Left 1028728947 7:94122645-94122667 CCTAATGCCCGCTCAAAGTCTCA No data
Right 1028728955 7:94122698-94122720 GGTATTGTGGTTTTAATTTGTGG No data
1028728947_1028728950 7 Left 1028728947 7:94122645-94122667 CCTAATGCCCGCTCAAAGTCTCA No data
Right 1028728950 7:94122675-94122697 TAATTTGAAAAGAGAACCAGTGG No data
1028728947_1028728952 9 Left 1028728947 7:94122645-94122667 CCTAATGCCCGCTCAAAGTCTCA No data
Right 1028728952 7:94122677-94122699 ATTTGAAAAGAGAACCAGTGGGG No data
1028728947_1028728953 17 Left 1028728947 7:94122645-94122667 CCTAATGCCCGCTCAAAGTCTCA No data
Right 1028728953 7:94122685-94122707 AGAGAACCAGTGGGGTATTGTGG No data
1028728947_1028728951 8 Left 1028728947 7:94122645-94122667 CCTAATGCCCGCTCAAAGTCTCA No data
Right 1028728951 7:94122676-94122698 AATTTGAAAAGAGAACCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028728947 Original CRISPR TGAGACTTTGAGCGGGCATT AGG (reversed) Intergenic