ID: 1028728949

View in Genome Browser
Species Human (GRCh38)
Location 7:94122653-94122675
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028728949_1028728952 1 Left 1028728949 7:94122653-94122675 CCGCTCAAAGTCTCATAATTTTT No data
Right 1028728952 7:94122677-94122699 ATTTGAAAAGAGAACCAGTGGGG No data
1028728949_1028728953 9 Left 1028728949 7:94122653-94122675 CCGCTCAAAGTCTCATAATTTTT No data
Right 1028728953 7:94122685-94122707 AGAGAACCAGTGGGGTATTGTGG No data
1028728949_1028728955 22 Left 1028728949 7:94122653-94122675 CCGCTCAAAGTCTCATAATTTTT No data
Right 1028728955 7:94122698-94122720 GGTATTGTGGTTTTAATTTGTGG No data
1028728949_1028728957 24 Left 1028728949 7:94122653-94122675 CCGCTCAAAGTCTCATAATTTTT No data
Right 1028728957 7:94122700-94122722 TATTGTGGTTTTAATTTGTGGGG No data
1028728949_1028728951 0 Left 1028728949 7:94122653-94122675 CCGCTCAAAGTCTCATAATTTTT No data
Right 1028728951 7:94122676-94122698 AATTTGAAAAGAGAACCAGTGGG No data
1028728949_1028728950 -1 Left 1028728949 7:94122653-94122675 CCGCTCAAAGTCTCATAATTTTT No data
Right 1028728950 7:94122675-94122697 TAATTTGAAAAGAGAACCAGTGG No data
1028728949_1028728956 23 Left 1028728949 7:94122653-94122675 CCGCTCAAAGTCTCATAATTTTT No data
Right 1028728956 7:94122699-94122721 GTATTGTGGTTTTAATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028728949 Original CRISPR AAAAATTATGAGACTTTGAG CGG (reversed) Intergenic