ID: 1028728952

View in Genome Browser
Species Human (GRCh38)
Location 7:94122677-94122699
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028728946_1028728952 10 Left 1028728946 7:94122644-94122666 CCCTAATGCCCGCTCAAAGTCTC No data
Right 1028728952 7:94122677-94122699 ATTTGAAAAGAGAACCAGTGGGG No data
1028728948_1028728952 2 Left 1028728948 7:94122652-94122674 CCCGCTCAAAGTCTCATAATTTT No data
Right 1028728952 7:94122677-94122699 ATTTGAAAAGAGAACCAGTGGGG No data
1028728947_1028728952 9 Left 1028728947 7:94122645-94122667 CCTAATGCCCGCTCAAAGTCTCA No data
Right 1028728952 7:94122677-94122699 ATTTGAAAAGAGAACCAGTGGGG No data
1028728949_1028728952 1 Left 1028728949 7:94122653-94122675 CCGCTCAAAGTCTCATAATTTTT No data
Right 1028728952 7:94122677-94122699 ATTTGAAAAGAGAACCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028728952 Original CRISPR ATTTGAAAAGAGAACCAGTG GGG Intergenic