ID: 1028728955

View in Genome Browser
Species Human (GRCh38)
Location 7:94122698-94122720
Sequence GGTATTGTGGTTTTAATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028728949_1028728955 22 Left 1028728949 7:94122653-94122675 CCGCTCAAAGTCTCATAATTTTT No data
Right 1028728955 7:94122698-94122720 GGTATTGTGGTTTTAATTTGTGG No data
1028728947_1028728955 30 Left 1028728947 7:94122645-94122667 CCTAATGCCCGCTCAAAGTCTCA No data
Right 1028728955 7:94122698-94122720 GGTATTGTGGTTTTAATTTGTGG No data
1028728948_1028728955 23 Left 1028728948 7:94122652-94122674 CCCGCTCAAAGTCTCATAATTTT No data
Right 1028728955 7:94122698-94122720 GGTATTGTGGTTTTAATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028728955 Original CRISPR GGTATTGTGGTTTTAATTTG TGG Intergenic
No off target data available for this crispr