ID: 1028728956

View in Genome Browser
Species Human (GRCh38)
Location 7:94122699-94122721
Sequence GTATTGTGGTTTTAATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028728948_1028728956 24 Left 1028728948 7:94122652-94122674 CCCGCTCAAAGTCTCATAATTTT No data
Right 1028728956 7:94122699-94122721 GTATTGTGGTTTTAATTTGTGGG No data
1028728949_1028728956 23 Left 1028728949 7:94122653-94122675 CCGCTCAAAGTCTCATAATTTTT No data
Right 1028728956 7:94122699-94122721 GTATTGTGGTTTTAATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028728956 Original CRISPR GTATTGTGGTTTTAATTTGT GGG Intergenic
No off target data available for this crispr