ID: 1028735008

View in Genome Browser
Species Human (GRCh38)
Location 7:94199073-94199095
Sequence GAAATGTACAGAGCTTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028735008_1028735014 21 Left 1028735008 7:94199073-94199095 CCTAGGCAAGCTCTGTACATTTC No data
Right 1028735014 7:94199117-94199139 CCATTATTTTCAAGGAGCTTTGG No data
1028735008_1028735011 13 Left 1028735008 7:94199073-94199095 CCTAGGCAAGCTCTGTACATTTC No data
Right 1028735011 7:94199109-94199131 AGATTCACCCATTATTTTCAAGG No data
1028735008_1028735015 22 Left 1028735008 7:94199073-94199095 CCTAGGCAAGCTCTGTACATTTC No data
Right 1028735015 7:94199118-94199140 CATTATTTTCAAGGAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028735008 Original CRISPR GAAATGTACAGAGCTTGCCT AGG (reversed) Intergenic
No off target data available for this crispr