ID: 1028747051

View in Genome Browser
Species Human (GRCh38)
Location 7:94338886-94338908
Sequence TGCATGCATTGCCAACTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028747051_1028747055 16 Left 1028747051 7:94338886-94338908 CCAAATAGTTGGCAATGCATGCA No data
Right 1028747055 7:94338925-94338947 CAAAATTTCCAGGCATAGGATGG No data
1028747051_1028747058 22 Left 1028747051 7:94338886-94338908 CCAAATAGTTGGCAATGCATGCA No data
Right 1028747058 7:94338931-94338953 TTCCAGGCATAGGATGGGGCTGG No data
1028747051_1028747054 12 Left 1028747051 7:94338886-94338908 CCAAATAGTTGGCAATGCATGCA No data
Right 1028747054 7:94338921-94338943 TGTTCAAAATTTCCAGGCATAGG No data
1028747051_1028747056 17 Left 1028747051 7:94338886-94338908 CCAAATAGTTGGCAATGCATGCA No data
Right 1028747056 7:94338926-94338948 AAAATTTCCAGGCATAGGATGGG No data
1028747051_1028747057 18 Left 1028747051 7:94338886-94338908 CCAAATAGTTGGCAATGCATGCA No data
Right 1028747057 7:94338927-94338949 AAATTTCCAGGCATAGGATGGGG No data
1028747051_1028747060 29 Left 1028747051 7:94338886-94338908 CCAAATAGTTGGCAATGCATGCA No data
Right 1028747060 7:94338938-94338960 CATAGGATGGGGCTGGAGAAAGG No data
1028747051_1028747053 6 Left 1028747051 7:94338886-94338908 CCAAATAGTTGGCAATGCATGCA No data
Right 1028747053 7:94338915-94338937 ATCAATTGTTCAAAATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028747051 Original CRISPR TGCATGCATTGCCAACTATT TGG (reversed) Intergenic
No off target data available for this crispr