ID: 1028747053

View in Genome Browser
Species Human (GRCh38)
Location 7:94338915-94338937
Sequence ATCAATTGTTCAAAATTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028747046_1028747053 30 Left 1028747046 7:94338862-94338884 CCCCAAGGTCTGGCAGATGGCCT No data
Right 1028747053 7:94338915-94338937 ATCAATTGTTCAAAATTTCCAGG No data
1028747050_1028747053 10 Left 1028747050 7:94338882-94338904 CCTGCCAAATAGTTGGCAATGCA No data
Right 1028747053 7:94338915-94338937 ATCAATTGTTCAAAATTTCCAGG No data
1028747051_1028747053 6 Left 1028747051 7:94338886-94338908 CCAAATAGTTGGCAATGCATGCA No data
Right 1028747053 7:94338915-94338937 ATCAATTGTTCAAAATTTCCAGG No data
1028747048_1028747053 28 Left 1028747048 7:94338864-94338886 CCAAGGTCTGGCAGATGGCCTGC No data
Right 1028747053 7:94338915-94338937 ATCAATTGTTCAAAATTTCCAGG No data
1028747047_1028747053 29 Left 1028747047 7:94338863-94338885 CCCAAGGTCTGGCAGATGGCCTG No data
Right 1028747053 7:94338915-94338937 ATCAATTGTTCAAAATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028747053 Original CRISPR ATCAATTGTTCAAAATTTCC AGG Intergenic
No off target data available for this crispr