ID: 1028747060

View in Genome Browser
Species Human (GRCh38)
Location 7:94338938-94338960
Sequence CATAGGATGGGGCTGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028747051_1028747060 29 Left 1028747051 7:94338886-94338908 CCAAATAGTTGGCAATGCATGCA No data
Right 1028747060 7:94338938-94338960 CATAGGATGGGGCTGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028747060 Original CRISPR CATAGGATGGGGCTGGAGAA AGG Intergenic
No off target data available for this crispr