ID: 1028751000

View in Genome Browser
Species Human (GRCh38)
Location 7:94382884-94382906
Sequence GACACAGTAGTGAATAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028750997_1028751000 9 Left 1028750997 7:94382852-94382874 CCAACACTGACTGTAACCATGAT No data
Right 1028751000 7:94382884-94382906 GACACAGTAGTGAATAAGACAGG No data
1028750999_1028751000 -7 Left 1028750999 7:94382868-94382890 CCATGATAGGTTTTATGACACAG No data
Right 1028751000 7:94382884-94382906 GACACAGTAGTGAATAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028751000 Original CRISPR GACACAGTAGTGAATAAGAC AGG Intergenic
No off target data available for this crispr