ID: 1028752716

View in Genome Browser
Species Human (GRCh38)
Location 7:94399384-94399406
Sequence TGTTAAAAAGAGGACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028752716_1028752720 19 Left 1028752716 7:94399384-94399406 CCACCACAGTCCTCTTTTTAACA 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1028752720 7:94399426-94399448 CTAAGATCCCTTAGGTAGCTTGG No data
1028752716_1028752719 11 Left 1028752716 7:94399384-94399406 CCACCACAGTCCTCTTTTTAACA 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1028752719 7:94399418-94399440 CTTTTGAACTAAGATCCCTTAGG 0: 1
1: 0
2: 1
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028752716 Original CRISPR TGTTAAAAAGAGGACTGTGG TGG (reversed) Intronic
901508106 1:9699424-9699446 TTTTAAGCAGAGGACTGAGGCGG - Intronic
904030334 1:27529467-27529489 TGTGAAAATGTGGACGGTGGTGG - Intergenic
907105828 1:51881685-51881707 CTTTAAAAAGAGGTCTCTGGCGG + Intergenic
908238574 1:62170265-62170287 TTTTAAAAAGCCCACTGTGGTGG - Intergenic
908259921 1:62332285-62332307 TGTTAGAGAGAGGTCTATGGTGG + Intergenic
909634085 1:77796090-77796112 TTTTAAAAAGAGGAGTATTGGGG - Intronic
910091304 1:83467515-83467537 TGTGAAGAAAATGACTGTGGAGG - Intergenic
910795934 1:91097560-91097582 TTTTAAAAAGAGAACAGAGGTGG - Intergenic
911067097 1:93799933-93799955 TGTTAAATAAAGGAGTGTGTAGG + Intronic
913653956 1:120943952-120943974 TGAGAAGAAGTGGACTGTGGTGG - Intergenic
914267498 1:146050568-146050590 TGAGAAGAAGTGGACTGTGGTGG + Intergenic
914519641 1:148404053-148404075 TGAGAAGAAGTGGACTGTGGTGG - Intergenic
914644149 1:149638120-149638142 TGAGAAGAAGTGGACTGTGGTGG - Intergenic
916483201 1:165234006-165234028 TTTTCAAAAGAGGAGTGGGGAGG - Intronic
916679516 1:167091173-167091195 TTTTAAAAAGATGATGGTGGTGG - Intergenic
916680067 1:167095504-167095526 TGGTAAAAAGAGGACTCTCCAGG - Intronic
916913930 1:169385228-169385250 TGTTAAATAGGAGAATGTGGTGG - Intronic
919025679 1:192166474-192166496 TGTTAAAAAGATAACTCTGATGG + Intronic
920764987 1:208823700-208823722 TGTTAATTTGAGGACTGGGGAGG + Intergenic
921109484 1:212019467-212019489 GGTTAAAAAGAAGACTGTCTGGG + Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
923052112 1:230396252-230396274 GGTAAAAAGGAGGAGTGTGGGGG - Intronic
924715389 1:246567998-246568020 TTTTAAAAAAAACACTGTGGTGG + Intronic
1065042813 10:21714874-21714896 TTTTATAAAGAGGACAGTGCAGG + Intronic
1066237180 10:33496970-33496992 TGGTAGAAAGATGACTGTGCAGG - Intergenic
1068212206 10:53934443-53934465 GGCTAAAAAAATGACTGTGGTGG + Intronic
1069095462 10:64254044-64254066 TATATAAAAGTGGACTGTGGAGG + Intergenic
1069417133 10:68210476-68210498 TGTAAGAGAGCGGACTGTGGAGG + Exonic
1070018130 10:72555768-72555790 TTTGAAACAGAGGCCTGTGGTGG - Intronic
1070319898 10:75346781-75346803 TTTTAATAAGCCGACTGTGGTGG - Intergenic
1072541951 10:96405284-96405306 TGTTTAAAAGCCGACTGTGCTGG - Exonic
1074456018 10:113595748-113595770 TGGTAAATAGAGAACTGTGTGGG + Intronic
1076502469 10:130948079-130948101 TGTACAGATGAGGACTGTGGTGG + Intergenic
1077448097 11:2611974-2611996 TGTTAATAAGAGTACTGAGAAGG - Intronic
1078583857 11:12562927-12562949 TCTTAAAAAGACAAATGTGGAGG + Intergenic
1078608151 11:12795717-12795739 TGTTAAAAATATGTATGTGGTGG - Intronic
1078696256 11:13635354-13635376 CGTTAAAGTGAGGACTCTGGAGG + Intergenic
1082007368 11:47426795-47426817 TGTAAAAATGCGGACTGAGGTGG - Intergenic
1083357167 11:62075398-62075420 GGTAAACAACAGGACTGTGGTGG + Intergenic
1085227569 11:74936256-74936278 CTTTACAAAGAGGACTGGGGTGG - Intronic
1085480080 11:76814666-76814688 TGTTTAAAAGAGGAATGTTTAGG - Intergenic
1085574977 11:77594518-77594540 TGTTACAAATAGGACTGTCTTGG + Intronic
1088463659 11:110110404-110110426 GGTAAAAAAGAGTACAGTGGGGG - Intronic
1090430447 11:126641852-126641874 TGTAAGCAAGGGGACTGTGGTGG - Intronic
1090851237 11:130572374-130572396 TGTGAAGAAAAGGCCTGTGGGGG - Intergenic
1090919172 11:131193098-131193120 TGTTAAAAACAGGGAGGTGGGGG + Intergenic
1091356289 11:134940465-134940487 TGTTCAAAAGAGCACTATGCAGG + Intergenic
1092726851 12:11495415-11495437 TGGCACAAAGTGGACTGTGGTGG - Intronic
1093379737 12:18478129-18478151 TTTTAAAAAAAGGACTGAGCTGG + Intronic
1093702371 12:22236502-22236524 CTTTAAAAAGAGGGCTGAGGAGG + Intronic
1094625244 12:32117604-32117626 TGTGAAAAAGAAGATTCTGGAGG - Intronic
1095050737 12:37552169-37552191 TGTAAAAATGTGGACTCTGGAGG - Intergenic
1095862695 12:46936174-46936196 TTTAAATAAGAGGAATGTGGGGG - Intergenic
1097294859 12:57951179-57951201 TAGTAAAATGAGGACAGTGGTGG + Intronic
1098012212 12:66065607-66065629 TTTGAAAAAGATGACTATGGTGG + Intergenic
1098318071 12:69212915-69212937 TTTTAAAAAGAATACTTTGGTGG - Intergenic
1098555497 12:71814085-71814107 TCTTAAAAAGATGACAGTGAGGG - Intergenic
1098603825 12:72365862-72365884 TGCTAAACCAAGGACTGTGGAGG + Intronic
1099655755 12:85488286-85488308 TGTTTTAAAGAGGACTCTGAAGG - Intergenic
1099876462 12:88412823-88412845 TGTTCTAATGAGCACTGTGGAGG - Intergenic
1100130369 12:91485327-91485349 TGTGAAAATTAGGACTGTGCTGG + Intergenic
1100685455 12:96982541-96982563 TGTTCAAGCCAGGACTGTGGAGG - Intergenic
1100690816 12:97037040-97037062 TGTTAAAAATAGAACTGATGAGG + Intergenic
1101306289 12:103530868-103530890 TGTTATAATGAGAGCTGTGGCGG - Intergenic
1101567691 12:105923662-105923684 GGTTAAAAAAAGGAATGTGGGGG - Intergenic
1101815746 12:108144832-108144854 TGTGAAAAAGAGGACAGTGATGG - Intronic
1102288250 12:111677178-111677200 TATTAAACAGGTGACTGTGGTGG + Intronic
1102971609 12:117172349-117172371 GGTTAAAAATAGGACTAGGGTGG - Intronic
1103151487 12:118643251-118643273 TGTAAAAATGAGGTCTCTGGAGG + Intergenic
1103341865 12:120225074-120225096 TGTTAAAAGCAGAACAGTGGGGG - Intronic
1106900864 13:34353731-34353753 TATTAAAAGGAAGACTGAGGTGG - Intergenic
1107525578 13:41228033-41228055 TGACAAGAAGAGGAATGTGGAGG - Intronic
1107700079 13:43038490-43038512 TATTAAAAATACGACTGGGGAGG + Intronic
1107736497 13:43404572-43404594 TGTTACAAAGAGGAATTGGGAGG - Intronic
1107777474 13:43861552-43861574 AGATAAGAAGAGGACTATGGAGG - Intronic
1108284250 13:48890476-48890498 AGTGAAAAAGAGGTCTGTGAAGG + Intergenic
1108556097 13:51594204-51594226 TATTAAAAAAAGGTGTGTGGTGG - Intronic
1109831902 13:67801830-67801852 TCTTAAAAAGAGGAGTGTCTTGG + Intergenic
1110729656 13:78865863-78865885 TGTTAAAAAAAACACTCTGGAGG + Intergenic
1114448376 14:22807352-22807374 AGTTAAAAGGAGAACTCTGGTGG - Intronic
1114729069 14:24971676-24971698 TTTTGAAAAGAGGATTGTGTGGG - Intronic
1115678687 14:35711770-35711792 TTTTAAAAAGAGGACTTGGGTGG - Intronic
1115697805 14:35919455-35919477 TGTTAAAAAAATGAATGTGAGGG - Intronic
1115788160 14:36849277-36849299 TGATACGAAGAGGACTTTGGGGG + Intronic
1115816387 14:37168758-37168780 TGTGAGAAAGAGGACTGAGGAGG + Intronic
1116380842 14:44265950-44265972 TGTTAATAAGAAGACTTAGGAGG + Intergenic
1116648074 14:47555583-47555605 TCTTAAAAATATGATTGTGGTGG - Intronic
1116965811 14:51013974-51013996 TGATGAAATGATGACTGTGGAGG - Intronic
1118651694 14:67902997-67903019 TGTTAAAAAGGGCATGGTGGTGG - Intronic
1118859467 14:69651243-69651265 TGTTAAAGAGAAGACTTAGGTGG + Intronic
1119182971 14:72616805-72616827 TGTTCAAAAGAGGACGGGGTTGG - Intergenic
1121777343 14:96599253-96599275 TGTCAGAAAGAGGAGTGAGGGGG + Intergenic
1124119132 15:26873897-26873919 TGGTTAAAAGAGGACTATAGGGG + Intronic
1124826831 15:33105367-33105389 TATTAAAAATAGGATTGTAGGGG + Intronic
1124862743 15:33458906-33458928 TGACAAAAAGAAGACAGTGGTGG - Intronic
1124925788 15:34069109-34069131 TTTTAAAAATTGGACTGTAGGGG - Intergenic
1131502180 15:92979152-92979174 AGTTACAAAGGGGACTGTGGAGG + Exonic
1134684305 16:16147966-16147988 TGTCAGAAAGAGGAGTGAGGAGG + Intergenic
1134862486 16:17572957-17572979 GGTTACAAAGGGGAGTGTGGTGG + Intergenic
1137024936 16:35464384-35464406 TGTTAAAATGAGGTCCTTGGGGG + Intergenic
1137757126 16:50911645-50911667 TATTAAAAGCATGACTGTGGAGG - Intergenic
1138462921 16:57163256-57163278 TTTTAAAAAGAAGAGTCTGGGGG - Intronic
1139116926 16:63965658-63965680 TTTTAAAAAGAGGGCAGTGAAGG - Intergenic
1140940601 16:79718434-79718456 TGTGAAGAAGAGGAATATGGAGG + Intergenic
1141126589 16:81404866-81404888 TTTTAAAAAGTGGAATTTGGGGG - Intergenic
1141130567 16:81433603-81433625 TGTAAAAAATATGACTGAGGCGG + Intergenic
1141735292 16:85848148-85848170 TATTAAATAGAGGACGGTGCTGG + Intergenic
1141771068 16:86089910-86089932 GGCTGAGAAGAGGACTGTGGAGG - Intergenic
1144922068 17:18772368-18772390 TGTCCACAAAAGGACTGTGGAGG - Intronic
1145371358 17:22309002-22309024 TGTAAAAATGTGGACTCTGGAGG - Intergenic
1146584168 17:34068156-34068178 TGTTGAGAAGAGGATTGTGGAGG - Intronic
1146999637 17:37352081-37352103 TACTAAAAAGACGAATGTGGTGG - Intronic
1148602041 17:48901555-48901577 TGTTAAAATGAGGATACTGGAGG + Intergenic
1149616451 17:58004947-58004969 TGTCAAAAGGAGGATTGAGGAGG - Exonic
1151212245 17:72553282-72553304 TGTGAAAAAGACACCTGTGGAGG + Intergenic
1154223350 18:12477198-12477220 AGTTAAAAGTAGGCCTGTGGGGG + Intronic
1154498349 18:14978831-14978853 TGTTCAAAAGAGCACTGTGCAGG - Intergenic
1155110259 18:22707793-22707815 TGGAAAAAAGAGAGCTGTGGGGG + Intergenic
1155890792 18:31265832-31265854 TGTTTAAAAGAGGTGTGAGGGGG + Intergenic
1157174618 18:45440064-45440086 AGCTAAAAAGAGGCCTGTGTAGG + Intronic
1157490454 18:48120208-48120230 GGTTTAAAAGATGACTCTGGGGG + Intronic
1158311136 18:56159706-56159728 TTTTAAAAAGTTGACTGTGATGG + Intergenic
1159588889 18:70310240-70310262 TTTTAAAAAAAGGAATGAGGAGG - Intronic
1160487524 18:79308032-79308054 TTTTAAAGAGAGGAGTCTGGTGG + Intronic
1161901304 19:7121617-7121639 TTTTAAAAAGTGGGGTGTGGTGG - Intronic
1163169316 19:15519687-15519709 TGTTAGAAAGGGGATTGTGGTGG + Intronic
1165239339 19:34451910-34451932 TGTTAAACAGAGCACAGTAGAGG + Intronic
1167245310 19:48369542-48369564 TATGAAAAGGAGGAATGTGGGGG - Intronic
1167978288 19:53251117-53251139 TTTGAAAAAGAAGACTGTTGGGG - Intronic
1168387574 19:55978409-55978431 TATAAAGAAAAGGACTGTGGAGG + Intronic
928544116 2:32313100-32313122 TGAGAAAAAGAGGCCTGTGGTGG + Exonic
929247576 2:39719715-39719737 TGTTAAAAAGGGGGGTGTGTGGG - Intergenic
929996344 2:46828493-46828515 TGTCAAGAGGAGGACTCTGGAGG - Intronic
930432723 2:51301221-51301243 TCTTAAAAAGAGGATTTTGAGGG + Intergenic
930744093 2:54863116-54863138 TGTTGACAAGAGTTCTGTGGTGG + Intronic
931544267 2:63363829-63363851 TGATAAAAAGTGGAATTTGGAGG - Intronic
931797751 2:65727978-65728000 TGTTCAGAAGAGGACTGATGAGG + Intergenic
932132136 2:69197283-69197305 TTTTACAAGGAGCACTGTGGTGG - Intronic
932830405 2:74984115-74984137 TTTTAAAAAGATGTCTGTGCTGG + Intergenic
935051680 2:99530055-99530077 TTTTACAAAGAGGAGTCTGGAGG + Intergenic
935610478 2:105018850-105018872 TGTTAAAGATAGGATTGTGTTGG - Intergenic
936770369 2:115905671-115905693 TGTTGAAAAGGGGGATGTGGTGG - Intergenic
938044089 2:128100710-128100732 TGTTAAACAGAGGCCTGGCGCGG - Intronic
939354765 2:141087028-141087050 TGGTAAATATAGGCCTGTGGCGG + Intronic
939850845 2:147302534-147302556 TCTTAAGAAGAGGATTGTGTAGG + Intergenic
940212602 2:151271036-151271058 TTTTAGAAAGAGAACTCTGGTGG + Intronic
940286144 2:152034736-152034758 TGTTTAAAAGAGCACTGTGGGGG - Intronic
942144181 2:173009999-173010021 AGGTAAAAAGAGTACTGGGGAGG + Intronic
943507524 2:188780026-188780048 TATTAAAAAATGGACTGTGCCGG - Intronic
944697381 2:202214558-202214580 TGCTAAAAAGAATATTGTGGTGG - Intronic
944724734 2:202459178-202459200 AGGTAAAAAGAGGAGTGTGAGGG - Intronic
945053221 2:205845489-205845511 TGTCAAAAAGATGAGCGTGGAGG + Intergenic
945326659 2:208490025-208490047 TTTTAAAAAGAGTAATGTAGTGG - Intronic
946660222 2:221991788-221991810 TTTAAAAAAGATGAGTGTGGGGG - Intergenic
948025053 2:234770168-234770190 TGATAAAAAGAGATCTGTGCTGG + Intergenic
1170163333 20:13337844-13337866 TGTTATAAATAGGAATTTGGTGG + Intergenic
1170745939 20:19099029-19099051 TGTTGCACAGACGACTGTGGCGG + Intergenic
1171166196 20:22974094-22974116 GGTTTTTAAGAGGACTGTGGAGG - Intergenic
1171545247 20:25995642-25995664 TGTAAAAATGTGGACTCTGGAGG - Intergenic
1171545353 20:25996746-25996768 TCTTATAAATAGGTCTGTGGGGG + Intergenic
1172689576 20:36781196-36781218 TCTTAAAAAGAGCACTGAGCAGG - Exonic
1172826292 20:37789724-37789746 TGTTAAAAAGTGCTTTGTGGTGG - Intronic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1173018113 20:39245284-39245306 TGTATAAAGGAGGACTGTGGGGG + Intergenic
1173230905 20:41196667-41196689 TTTTCAAAAGAGGACACTGGAGG + Intronic
1174988522 20:55483012-55483034 TGTTAAAAAAAGGACTGCATCGG + Intergenic
1180861084 22:19083389-19083411 TGTGAAGAAGAGGAATGAGGAGG - Intronic
1184316198 22:43691889-43691911 TGCTAACAGGAGAACTGTGGGGG + Intronic
949360524 3:3227591-3227613 TGGTAATAATAGGACTGGGGCGG + Intergenic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
951922516 3:27872079-27872101 TGTTAATAAGGCGACTCTGGTGG + Intergenic
953103128 3:39849628-39849650 TGTTAAAAGGAGGATTTTTGGGG + Intronic
954961482 3:54569295-54569317 TTTTAAAAACAGGAGTGAGGAGG + Intronic
956403919 3:68908311-68908333 TGTTAAGAGAAGGACTCTGGAGG - Intronic
957366072 3:79225653-79225675 AGTTATGAAGAGGACTGTGGAGG - Intronic
957717512 3:83948274-83948296 TTTTAAAAAGAGGATTCTTGTGG - Intergenic
958672573 3:97223437-97223459 TGTTAAAAAAAGCCCTGTTGTGG + Intronic
958832290 3:99104210-99104232 TGTGGAAAAGATGACTTTGGTGG - Intergenic
959872392 3:111342974-111342996 AGTGAAAAAGAGCACTGAGGGGG - Intronic
961150439 3:124633053-124633075 TTTTGAAAACAGGACTGTGCTGG + Intronic
961761219 3:129169491-129169513 TATTAAAGAGGGGAATGTGGAGG - Intronic
961993934 3:131220968-131220990 TGTGAAAAAGAGGAAAGGGGTGG + Intronic
964732290 3:159880174-159880196 TGCCAAAGAGAGGACTGGGGAGG - Intronic
966021305 3:175215036-175215058 GGAAAAAAAGAGGGCTGTGGTGG - Intronic
966025320 3:175272392-175272414 TTTAAAAATGAGGACTGTGTAGG + Intronic
966373759 3:179274876-179274898 TGTTACAATGAGGAATCTGGGGG + Intergenic
967900734 3:194449123-194449145 TGTGAAAATGAGTAATGTGGTGG + Intronic
968118491 3:196108038-196108060 TGTTAAAAAGATGACAGGCGCGG - Intergenic
968826136 4:2898848-2898870 TTTTTCAAAGAGTACTGTGGGGG - Intronic
972007090 4:34123058-34123080 TGATAAAAAGAGGACATTCGTGG - Intergenic
974000709 4:56508042-56508064 TATTAAAATGTGGAATGTGGGGG + Intronic
976061843 4:81137762-81137784 TGTTAAAAAGATGGCCTTGGAGG - Intronic
978061286 4:104343830-104343852 TTTTAAAAAGAGGAGGTTGGTGG - Intergenic
981156681 4:141445602-141445624 TGGTAAAATGATGGCTGTGGTGG + Intergenic
981938414 4:150257281-150257303 TATTAAAAAGAGCAGGGTGGTGG - Exonic
982365200 4:154570444-154570466 TGTTCTAAAGAAGACGGTGGTGG + Exonic
983068721 4:163243477-163243499 TGTGCAGAAGAGGACTGTGTAGG + Intergenic
984446323 4:179841454-179841476 TTTGAACAAGAGGACTGGGGAGG - Intergenic
984833813 4:184000459-184000481 TTTCAGAAAGATGACTGTGGTGG - Intronic
984871875 4:184332862-184332884 TGTTAAAAAGAGGGCTGAGAGGG - Intergenic
986517043 5:8574923-8574945 TGTTAAAAAGAGCATGGTGCTGG - Intergenic
987515582 5:18902911-18902933 TGTTAAAAAGAGGCCGGGCGCGG - Intergenic
988499543 5:31772994-31773016 TGTGAGACAGAGGACTTTGGAGG + Intronic
990024359 5:51167378-51167400 AGATAAAAAGAGTTCTGTGGGGG - Intergenic
991070628 5:62475586-62475608 TGTTAAACATATGACTGTTGTGG - Intronic
991444675 5:66686279-66686301 TGTTAAACAGATTACTGTGCTGG - Intronic
991937726 5:71818374-71818396 TGTTATAGAGAGGACATTGGAGG - Intergenic
992106484 5:73452238-73452260 TGTTAAAATCAAGAGTGTGGGGG + Intergenic
992186031 5:74245486-74245508 TCTTAAAGAAAGGATTGTGGGGG - Intergenic
992835014 5:80631501-80631523 AGATTAAAAGAGGCCTGTGGAGG - Intronic
998365934 5:141631162-141631184 TGTGAAAAACAGAACTGTAGGGG + Intronic
999050383 5:148517763-148517785 TGTTAAAAAGCAGACTGTAAGGG - Intronic
1000152145 5:158513821-158513843 TGTTAAAAAGAAGAACGAGGAGG + Intergenic
1001211693 5:169815772-169815794 TGTTGATAAGAGGACTGTGCAGG - Intronic
1003340378 6:5214516-5214538 TTTGAAAAAGATCACTGTGGTGG + Intronic
1003428551 6:6017426-6017448 TTTTGGAAAGAAGACTGTGGAGG + Intergenic
1003477730 6:6499616-6499638 TTTTAAAAACAGCACTGTGGAGG + Intergenic
1004278676 6:14260100-14260122 TTTTAAAAAGATGTCCGTGGAGG - Intergenic
1005601448 6:27430395-27430417 TGTCAAAAAAAGGACTTTGCAGG + Intergenic
1006179930 6:32148685-32148707 TGCAAAAAACAGGAGTGTGGGGG + Exonic
1006764163 6:36490187-36490209 TGTCAAAAAGTGGGATGTGGAGG + Exonic
1007101547 6:39250999-39251021 GGTTATGAAGAGGACTGTGTAGG - Intergenic
1009611453 6:65946766-65946788 TGTTACAATCAGGAGTGTGGTGG + Intergenic
1009842687 6:69096527-69096549 TTTTAAAAATAGGACAATGGGGG - Intronic
1011456139 6:87551745-87551767 TGGTAAAATGAGAATTGTGGAGG - Intronic
1011916911 6:92517746-92517768 TGTTAAAAATAGAATTGGGGTGG - Intergenic
1012741547 6:103021899-103021921 TGAGACAAAGAGGACTGTGGTGG + Intergenic
1012744895 6:103073586-103073608 TGTTAAAAAGACGAAGGTGGGGG + Intergenic
1013862822 6:114657512-114657534 TGGTATAAAGAGCAATGTGGAGG + Intergenic
1014046615 6:116896027-116896049 TGATAAAAAGAGCAATCTGGAGG - Intronic
1015367235 6:132409783-132409805 TGTTAAAAAGGGCATTGTGGGGG + Intergenic
1017574097 6:155782380-155782402 TGTCAGAAAGAGGACTGAGAGGG - Intergenic
1018003825 6:159602404-159602426 GGGTCAAAAGAGGAGTGTGGTGG - Intergenic
1025296663 7:57780697-57780719 TGTAAAAATGTGGACTCTGGAGG - Intergenic
1025296762 7:57781799-57781821 TCTTATAAATAGGTCTGTGGGGG + Intergenic
1027308147 7:76923964-76923986 TGTGAAAAAAATGACTGTGGAGG - Intergenic
1027644398 7:80779048-80779070 TGTTATAGAGAGCACTGTGCTGG - Intronic
1028752716 7:94399384-94399406 TGTTAAAAAGAGGACTGTGGTGG - Intronic
1029048447 7:97657151-97657173 TGTTAGAAAGAGGACTTTTATGG + Intergenic
1031063978 7:117084239-117084261 TGTTAGAAAGATGACTCAGGTGG + Intronic
1032263345 7:130353538-130353560 TGAGATAAAGAGGGCTGTGGAGG - Intronic
1033242207 7:139689814-139689836 TGAGAAAAAGAGGACTGGGAAGG + Intronic
1033315704 7:140295537-140295559 TGATGAAAAGAGGAGTGTGTGGG - Intronic
1033853755 7:145531502-145531524 TGAGAGAAAGAAGACTGTGGTGG + Intergenic
1034001354 7:147416526-147416548 TGAAACAAAGGGGACTGTGGAGG - Intronic
1034635917 7:152567022-152567044 TGTTAAAAAGATTACTCTAGTGG - Intergenic
1035038745 7:155912156-155912178 TGTTCTAAACAGGACAGTGGGGG - Intergenic
1036391185 8:8325611-8325633 TGTGAAAAACAAAACTGTGGCGG + Intronic
1036625954 8:10471704-10471726 TGTTAACACAAGAACTGTGGGGG - Intergenic
1039217634 8:35290646-35290668 TTTTAAAAAAAGAAGTGTGGAGG + Intronic
1043292806 8:78624525-78624547 TATTTAAAATAGGACAGTGGTGG - Intergenic
1044649748 8:94481676-94481698 TTTTAAAAAGGGGACTGATGGGG - Intergenic
1045257254 8:100536813-100536835 TGTTAAAAGCAGAACTTTGGGGG + Intronic
1045427158 8:102078377-102078399 TTTTTAAAAGATCACTGTGGTGG - Intronic
1046021096 8:108666029-108666051 TGTTGAATAGAAGACTGTGGAGG + Intronic
1046185305 8:110706832-110706854 TGTTAAAAAATAGACTGTGTTGG + Intergenic
1047042357 8:121010014-121010036 TGTTCAAAAAAGGAATTTGGGGG + Intergenic
1047304547 8:123642345-123642367 TTTTAAAAAGATCACTCTGGCGG + Intergenic
1048054602 8:130851553-130851575 TGTTTGAAAGACAACTGTGGTGG + Intronic
1051034339 9:12725220-12725242 TTTTGAAAAGAGGAGGGTGGAGG + Intergenic
1051294017 9:15575704-15575726 TGTTAAAAGGAGGACTGGCTGGG - Intronic
1052643634 9:31202855-31202877 AGTTAAAAAGTGGGCTGAGGTGG + Intergenic
1059102000 9:111481194-111481216 TGTCAAAAACAGTACAGTGGGGG + Intronic
1059893678 9:118834973-118834995 TTTTAAGAAGGGGACTGGGGAGG - Intergenic
1059942973 9:119375994-119376016 TGTTAGAAAGAGGAGTTAGGAGG - Intergenic
1185662158 X:1736060-1736082 TCTGAAAAAGAGGAGTGGGGAGG - Intergenic
1186353846 X:8769081-8769103 TGTTAAAAAGAGGGATGTTTAGG - Intergenic
1186933146 X:14416913-14416935 TTTTAAAAAGAGAGCTCTGGAGG + Intergenic
1187425046 X:19170250-19170272 TGTTCAAAAACGGACTGAGGAGG + Intergenic
1187709148 X:22036794-22036816 TCTTAAAAACAGGACTGAGATGG + Intronic
1188842694 X:35036346-35036368 TGTTTAAAATAGTACTTTGGAGG + Intergenic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1192710660 X:73581788-73581810 TGTTAAAAAGAAGAAAGTGTTGG + Intronic
1192958413 X:76098941-76098963 GGCTAAAAAGAGTAGTGTGGTGG - Intergenic
1194482210 X:94440459-94440481 TGTTAAAAAGAGGGATGTTTAGG - Intergenic
1196014215 X:110920169-110920191 TGTTAAAAAGAGGATAGAGGAGG - Intergenic
1196064340 X:111446373-111446395 TCTTAAAAATTGGTCTGTGGTGG + Intergenic
1196170494 X:112582424-112582446 TGATCAAAAGAGCACTGGGGTGG + Intergenic
1199121200 X:144056067-144056089 TAGTAGAAAGTGGACTGTGGGGG - Intergenic
1199391344 X:147283300-147283322 AGTTAAGATGAGGAATGTGGGGG - Intergenic
1199391562 X:147285999-147286021 AGTTAAGATGAGGAATGTGGGGG - Intergenic