ID: 1028753998

View in Genome Browser
Species Human (GRCh38)
Location 7:94413918-94413940
Sequence CAGGGTCCCCCTGGTCCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 1, 2: 15, 3: 93, 4: 493}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028753991_1028753998 15 Left 1028753991 7:94413880-94413902 CCTGTCACTTTCAGGGTGTTCAA 0: 1
1: 0
2: 0
3: 18
4: 261
Right 1028753998 7:94413918-94413940 CAGGGTCCCCCTGGTCCTCCAGG 0: 1
1: 1
2: 15
3: 93
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028753998 Original CRISPR CAGGGTCCCCCTGGTCCTCC AGG Exonic
900112433 1:1014148-1014170 CAGGGTCCCCCTTGCCAGCCAGG + Exonic
900176506 1:1293646-1293668 GAGGCTGCCCCTGGTCCCCCGGG - Exonic
900341842 1:2193353-2193375 CCGGGTCCACCTGGCCATCCTGG - Intronic
900466864 1:2830018-2830040 CAGCGTCTTCCTGGTCCCCCTGG + Intergenic
900617839 1:3573276-3573298 CAGGTAACCCCTAGTCCTCCTGG + Intronic
901787492 1:11634401-11634423 CAGGGTCTCCCTGGCACTTCTGG - Intergenic
901807734 1:11748796-11748818 CAGGGGTCCCCTGGTTGTCCTGG + Intronic
902368991 1:15993799-15993821 CGGGGTCCCCATGGGCTTCCTGG - Intergenic
902458497 1:16553678-16553700 CAGGGTGACCCTGGGCCTCCAGG + Intergenic
902493663 1:16854238-16854260 CAGGGTGACCCTGGGCCTCCAGG - Intronic
902716490 1:18276343-18276365 CAAGGTCCCCCTCCTTCTCCAGG + Intronic
903101508 1:21034937-21034959 CAGGGTCCCCCTGCAGCCCCAGG - Intronic
903151683 1:21414437-21414459 CAGGGCGACCCTGGGCCTCCAGG + Intergenic
904562041 1:31405508-31405530 CAGGGTCTCCCAGGACCTCTGGG - Intergenic
904599364 1:31665215-31665237 CAGGGTCCCCCTGGATTCCCAGG - Exonic
904600589 1:31670627-31670649 CAGGGCCCCCCAGGTTTTCCTGG - Exonic
904602162 1:31679666-31679688 CAGGGTCCACCAGGTATTCCCGG - Exonic
905010152 1:34741804-34741826 CCAGGTCCTCCAGGTCCTCCAGG - Intronic
905010155 1:34741813-34741835 CCAGGTCCTCCAGGTCCTCCAGG - Intronic
905168671 1:36098080-36098102 CCGGGACCCCCTGGTGCCCCTGG - Exonic
905168869 1:36098590-36098612 GGGGGTCCCCCTGGACTTCCTGG - Exonic
905169192 1:36099397-36099419 CGGGGTCCCCCTGGCCCCCCTGG - Exonic
905731842 1:40303591-40303613 CAGGGCTACCCTGGTCCCCCCGG - Exonic
905734345 1:40315615-40315637 CCGGGTCCCCCGGGACCGCCGGG - Exonic
905734352 1:40315624-40315646 CGGGGCCCCCCGGGTCCCCCGGG - Exonic
907287328 1:53390256-53390278 CTGGGTGCCCCTGGGCATCCTGG + Intergenic
907287554 1:53391494-53391516 CTGGGTGCCCCTGGGCATCCTGG - Intergenic
909649720 1:77960413-77960435 CATGGACCTCCTGGGCCTCCAGG - Exonic
910334795 1:86115359-86115381 AAGGGTCCACCTGGTCCAGCAGG - Exonic
910768762 1:90809697-90809719 CAAGGAACTCCTGGTCCTCCTGG + Intergenic
911856860 1:102888873-102888895 TTAGGTCCACCTGGTCCTCCAGG - Exonic
911858941 1:102921552-102921574 CAGGGGCCACCTGGTCCTCCAGG - Exonic
911860065 1:102935094-102935116 CAGGGCCCTCCCGGTCCCCCAGG - Exonic
911860888 1:102946865-102946887 CAGGGTCCTCCTGGTCCAGCTGG - Exonic
911864273 1:102996023-102996045 CAGGGTCCCCCTGGTCCACAAGG - Exonic
911864592 1:103001932-103001954 CAAGGTCCAATTGGTCCTCCTGG - Exonic
911864814 1:103004624-103004646 CAAGGTCCTCCAGGTCCTCCTGG - Exonic
911864916 1:103006278-103006300 CAGGGTCCCCCTGGTCCAACGGG - Exonic
911865510 1:103015687-103015709 GATGGTCTACCTGGTCCTCCTGG - Exonic
913607145 1:120476683-120476705 CAGGGTGACCCTGGGCCTCCAGG - Intergenic
913988208 1:143584920-143584942 CAGGGTGACCCTGGGCTTCCAGG + Intergenic
914209286 1:145563462-145563484 CAGGGTGACCCTGGGCCTCCAGG + Intergenic
914268206 1:146055830-146055852 CAGGGTGACCCTGGGCCTCCAGG + Intergenic
914368891 1:147005032-147005054 CAGGATGACCCTGGGCCTCCAGG - Intergenic
914584048 1:149045155-149045177 CAGGGTGACCCTGGGCCTCCAGG + Intronic
919371176 1:196727961-196727983 GAGGGTCCCCAAGATCCTCCCGG - Intronic
920173723 1:204087348-204087370 CAGGGTCCAGCTGGTGCCCCTGG - Intronic
920512621 1:206562184-206562206 CAGGATCCCTGTGGTACTCCAGG + Intronic
920658316 1:207893000-207893022 CAGGATCCACCTGCTCCTCTTGG - Intronic
920666090 1:207963832-207963854 CAGGGTTCCCCTGGCCCGCGCGG - Intergenic
920675285 1:208034065-208034087 CTGGGGCCCCCAGGCCCTCCGGG - Intronic
922660858 1:227429268-227429290 GGGGGTCCCCCTGGATCTCCAGG + Intergenic
922758446 1:228109516-228109538 CCGGCCCGCCCTGGTCCTCCCGG - Intergenic
922763755 1:228147324-228147346 CAGGGACACCCAGGCCCTCCCGG - Intronic
922786952 1:228287580-228287602 CAGGGTCCCCCTTCTCCTTTGGG - Intronic
924594793 1:245435642-245435664 CAGTTTCCTCCTGTTCCTCCCGG + Intronic
1063015922 10:2076802-2076824 CAGGGACACCCTGATCTTCCCGG + Intergenic
1063201220 10:3786067-3786089 TAGGGTCCCCTCTGTCCTCCGGG + Intergenic
1063236439 10:4121581-4121603 CAGGGTTGCACTGGTCTTCCAGG + Intergenic
1064560294 10:16588973-16588995 TAGGGTCCCCCTACTCCTCCAGG - Intergenic
1065021991 10:21508959-21508981 CGGGGTCCCCCAGGCCCGCCCGG + Intergenic
1065471116 10:26081917-26081939 GAGGGTCTCCCGGGTCCTGCAGG + Intronic
1067980096 10:51074580-51074602 CAAGGTGCCCATGCTCCTCCGGG - Exonic
1069636565 10:69928934-69928956 TAGGGGCCTCCTGGTCTTCCTGG + Exonic
1069907435 10:71740027-71740049 CAGGCTCTCCCTCATCCTCCTGG - Intronic
1070219280 10:74423497-74423519 CAGAGTGCACCTGGTGCTCCAGG - Intronic
1070609821 10:77925950-77925972 CAGGGTCCCCGGGGGCCACCAGG - Intronic
1070828528 10:79404969-79404991 CAGGGGCACCCTGGTCTCCCTGG + Intronic
1072426993 10:95338057-95338079 CAGGGTCAACCTGGGCCCCCAGG + Intronic
1073494987 10:103882719-103882741 CAATGTCACTCTGGTCCTCCAGG + Exonic
1073509715 10:104035322-104035344 CCAGGTCCCCCGGGTCCACCAGG - Exonic
1073510131 10:104037719-104037741 CAGGGTCCCCCAGGCCCACCTGG - Exonic
1073510264 10:104038462-104038484 CCTGGGCCCCCTGGGCCTCCGGG - Exonic
1073510872 10:104041502-104041524 CAAGGTCCCCCAGGCCCACCCGG - Exonic
1074208561 10:111305903-111305925 CAGGGCCCCCCTTTTCCTCTTGG - Intergenic
1075504376 10:123009095-123009117 CAAGGTCGCCCTGGGCCCCCAGG - Intronic
1075650976 10:124128254-124128276 CAGGGTCCCACTGCTGCTCAGGG - Intergenic
1075744219 10:124715393-124715415 CAGGGTGCTCCTGGGCCTGCAGG + Intronic
1076196767 10:128524199-128524221 CAGGGTCCAACTGGTCAACCAGG + Intergenic
1076632901 10:131862675-131862697 CAGGACACCCCTTGTCCTCCAGG + Intergenic
1076837877 10:133030199-133030221 CAGGCTCCTCCTGTTCCTCCGGG + Intergenic
1077231382 11:1459520-1459542 GAGGGTCCCGCTGGTCCCACTGG + Intronic
1077361538 11:2142842-2142864 CAGGGTCTCCCGGGTCCCTCTGG - Intronic
1077364781 11:2157224-2157246 CAGGCTGCCCTCGGTCCTCCAGG + Intronic
1077420080 11:2445921-2445943 CAGAGTCCACCTGGGCCTCAGGG - Intronic
1079356017 11:19730774-19730796 TAGTGTCCCCTTGGTCCTCAGGG + Intronic
1081484663 11:43518384-43518406 CAGGGTCTCACTTGTCATCCAGG - Intergenic
1081760076 11:45571036-45571058 CAGGGTTCTCCTGGTGATCCAGG - Intergenic
1083613499 11:64015404-64015426 CAGGGTCTTCCCAGTCCTCCGGG + Intronic
1084117370 11:67050097-67050119 CAGGGTGCCCCTCGTACTCCAGG - Exonic
1084195649 11:67522635-67522657 CGGGGTCCCCCTGCTCCTTGGGG + Exonic
1084254668 11:67932230-67932252 CATGGTCACCCTGGCCCTGCTGG - Intergenic
1084307747 11:68297951-68297973 CTGGGTCACTCTGGCCCTCCCGG + Intergenic
1084566100 11:69930051-69930073 CAGGTTCACGCTGCTCCTCCTGG - Intergenic
1084818205 11:71663657-71663679 CATGGTCACCCTGGCCCTGCTGG + Intergenic
1085779298 11:79393927-79393949 CAGTGTCACCCTCTTCCTCCAGG - Intronic
1086400480 11:86457373-86457395 CAGGGTCCCCAAGTACCTCCAGG + Intronic
1088735658 11:112725776-112725798 CAGGGTCCTCCCTGTCCTCAGGG + Intergenic
1089515359 11:119028541-119028563 CAGGCTCCTCCTGTTCCTCTGGG - Intronic
1089571055 11:119410057-119410079 CAGCTTCCACCTGGTTCTCCTGG - Intergenic
1089602886 11:119626009-119626031 CAGGGTCCCCCTGCCCTTCAGGG + Intronic
1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG + Intronic
1090729460 11:129557583-129557605 CAGGTGCACCCTGGTCCTCTGGG - Intergenic
1091026928 11:132149742-132149764 CAGGGTCACCCTCCTCCCCCAGG - Intronic
1091694494 12:2618602-2618624 CAGGGTTCCCCTGGCCCCTCAGG - Intronic
1092245445 12:6861540-6861562 CAGGGGCCCCGTAGGCCTCCAGG - Exonic
1092294939 12:7190046-7190068 AAGCGTCCCCGTGGTCCCCCGGG + Intronic
1092644870 12:10559453-10559475 CAGGGTCCCCCTGGGCCTCCTGG - Intergenic
1092659404 12:10722711-10722733 CAGGGTCCCCAGGGATCTCCGGG - Intronic
1092708401 12:11308756-11308778 CAAGGTCCCCCACCTCCTCCAGG - Exonic
1092712472 12:11353390-11353412 CAAGGTCCCCCACCTCCTCCAGG - Exonic
1092712528 12:11353573-11353595 CAAGGTCCCCCACCTCCTCCAGG - Intronic
1092712583 12:11353756-11353778 CAAGGTCCCCCACCTCCTCCAGG - Intronic
1092712642 12:11353939-11353961 CAGGGCCCCCCACCTCCTCCAGG - Exonic
1092716210 12:11393110-11393132 CAAGGTCCCCCACCTCCTCCAGG - Exonic
1092716262 12:11393296-11393318 CAAGGTCCCCCACCTCCTCCAGG - Exonic
1092716317 12:11393482-11393504 CAAGGTCCCCCACCTCCTCCAGG - Exonic
1092716422 12:11393851-11393873 CAAGGTCCCCCACCTCCTCCAGG - Exonic
1092716441 12:11393914-11393936 CAAGGTCCCCCATCTCCTCCAGG - Exonic
1093172203 12:15873989-15874011 GAGGGTCTCCCAGGTCCTGCAGG - Intronic
1094852454 12:34388388-34388410 CAGGGACCCCCAGGTTCCCCTGG + Intergenic
1094852666 12:34389230-34389252 CAGGGTCTCCCAGGGTCTCCTGG - Intergenic
1095981169 12:47975568-47975590 CCTGGACCCCCTGGTCCTCCAGG - Exonic
1095981174 12:47975586-47975608 CAGGGTCCTCCTGGAAATCCTGG - Exonic
1095981882 12:47978721-47978743 CCTGGTCCCCCTGGTCCTTCTGG - Exonic
1095981887 12:47978730-47978752 CCTGGACCCCCTGGTCCCCCTGG - Exonic
1095982889 12:47982873-47982895 CAGGGTCCCCGTGGCCTCCCCGG - Exonic
1095985288 12:47995271-47995293 CGTGGTCCTCCTGGTCCCCCTGG - Exonic
1095985292 12:47995280-47995302 ATGGGTCCCCGTGGTCCTCCTGG - Exonic
1095985611 12:47997616-47997638 CCCGGCCCCCCTGGTCCCCCTGG - Exonic
1095985620 12:47997634-47997656 CCTGGCCCCCCTGGTCCTCCCGG - Exonic
1095985636 12:47997688-47997710 AAGGGTGCCCCTGGACCTCGTGG - Exonic
1096154851 12:49336251-49336273 CGGGGGCCCCCTGGACCACCAGG - Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1098953134 12:76662505-76662527 TAGGATCACCCTGGTCCTTCAGG + Intergenic
1101565020 12:105896892-105896914 CAGGCTCAACCTGGTCCTACAGG - Intergenic
1101733072 12:107442695-107442717 AAGAGTCCCCCTGGGCCTCCAGG - Intronic
1104735312 12:131132668-131132690 CTGAGTCCCCATCGTCCTCCAGG - Intronic
1108781701 13:53844052-53844074 CAGGGTCTCCCTGGTACTTCGGG - Intergenic
1113420166 13:110164963-110164985 CCGGGTCCTCCTGGCCCCCCAGG - Exonic
1113424277 13:110195058-110195080 CAGGGTCCTCCTGGAATTCCAGG - Exonic
1113424705 13:110198493-110198515 CCGGGTCCTCCTGGTTCCCCTGG - Exonic
1113426034 13:110209408-110209430 CAGGGTCCCCCAGGCCCTCCCGG - Exonic
1113453726 13:110432322-110432344 CAGGGACCACCTGGACCCCCTGG + Exonic
1114147960 14:19999826-19999848 AAGGGTCCCCCTGGCCCACATGG - Intergenic
1117790065 14:59331245-59331267 AAGGGCCCTCCTGGTGCTCCAGG - Exonic
1121101412 14:91253048-91253070 CAGGGTCCAGGTGGTCCTCTGGG - Intronic
1121118154 14:91357954-91357976 GAGGCCACCCCTGGTCCTCCTGG - Intronic
1121217223 14:92257918-92257940 CAGGGTCTCCCTAGTTGTCCAGG - Intergenic
1121744170 14:96274999-96275021 CAAGGTCACCCTGGTCCCACTGG - Intergenic
1122130077 14:99599847-99599869 CAGGGTCTCTCTGGTCACCCAGG - Intronic
1122330163 14:100906536-100906558 CTGGGTTCGCCTGGACCTCCTGG + Intergenic
1122470859 14:101964997-101965019 CAGGGCCTGCCAGGTCCTCCGGG + Intronic
1122880870 14:104689906-104689928 CAGGGCGCCCCTGGCCCCCCCGG + Intronic
1123110287 14:105863977-105863999 CAGGGCCACCCTGGGCCTCTGGG - Intergenic
1124665276 15:31586865-31586887 CTGGGTCCTCCTCCTCCTCCTGG + Intronic
1125328543 15:38561636-38561658 CAGGGGCACCCTGGCCCTTCAGG + Intronic
1125725931 15:41868176-41868198 CCTGGTCCCGCTGGTCCTGCAGG + Exonic
1126098929 15:45108132-45108154 CAGGGTCCCCATGGCTCTCCAGG + Exonic
1126104858 15:45140963-45140985 CAGGGTCCCGGTGGCTCTCCAGG - Exonic
1127344211 15:58078386-58078408 CAGGTTCCTCCTGGGCCTGCTGG + Intronic
1128577255 15:68784454-68784476 CAGGGGCCTCCTTGTCGTCCCGG + Exonic
1128627279 15:69222451-69222473 CAGGCTCACCCTGGTCCCACAGG + Intronic
1129298161 15:74611072-74611094 CAGGGTCCCTGTGGCCCCCCAGG - Intronic
1129406421 15:75322043-75322065 CAGGTTCCTCCTGGTCCTCTTGG + Intergenic
1129673842 15:77621886-77621908 GGGGGTCCCCCTGGTCCCCGAGG - Intronic
1130128733 15:81117926-81117948 CAGGGGCTTCCTGGTCCTCTGGG + Intronic
1130300743 15:82678517-82678539 CACTGTCCCCCTTGTCTTCCAGG + Intronic
1130926237 15:88387942-88387964 TAGGGGGCCCCTGGTCATCCTGG - Intergenic
1131078411 15:89513758-89513780 CAGGGTCCCTCTGTCCCTACTGG + Intergenic
1132554714 16:567400-567422 CCGGGTCCTCCTGGTCCTGAGGG - Intronic
1132623644 16:879843-879865 CAGGATCCCCCCGGCCCGCCTGG + Intronic
1132730443 16:1358406-1358428 CAGTGTCCCCAAGGTCCCCCAGG + Intronic
1132761142 16:1509170-1509192 CAGGGCCCCCCTGCTCCTCCTGG - Intronic
1132849207 16:2016866-2016888 TCTGGTCCCCGTGGTCCTCCAGG + Intronic
1132907086 16:2288203-2288225 CTGCGTCACCCTGGCCCTCCTGG - Exonic
1132911533 16:2315687-2315709 CAGGGTCCCTCTCGTTCTCCAGG + Intronic
1133348993 16:5089170-5089192 CAGGAGCCCGCTGGTGCTCCCGG + Exonic
1134272719 16:12747404-12747426 CAGAGTCCCCCTTTTCGTCCAGG - Intronic
1134817682 16:17219557-17219579 CAGGGTCTCTCTGGTCTTCCAGG - Intronic
1135099401 16:19593134-19593156 CAGGGGCCTCCTGCTCCTCCAGG - Intronic
1136578954 16:31140609-31140631 CAGGCCCCCCCTGGCCCTCCTGG - Exonic
1136683604 16:31981736-31981758 CAGGAGCCCCCTGCTCCACCCGG - Intergenic
1137589277 16:49683634-49683656 CAGGGGGCCCCTCTTCCTCCCGG - Intronic
1137683119 16:50368524-50368546 CCGGGTCCCCCTGGTCCGGTGGG - Intronic
1138059083 16:53870180-53870202 CAGGGTCTCACTTGTCATCCAGG - Intronic
1138585989 16:57970845-57970867 CTAGGTCCCCCAAGTCCTCCTGG + Intronic
1139841343 16:69883273-69883295 CACGGTCACCCTGGTCAACCAGG - Intronic
1140133452 16:72184159-72184181 CAGGTTCTTCCTGGTCTTCCTGG + Intergenic
1141733246 16:85836092-85836114 CAGGCTCCCCCTGGCCTTTCTGG + Intergenic
1141916463 16:87100609-87100631 CAGGGTTCCCCTCTTCCTGCTGG - Intronic
1141957633 16:87383359-87383381 CAGGGACCCCCCGCCCCTCCCGG + Intronic
1142309499 16:89304094-89304116 CAGAGGCCTCCTTGTCCTCCTGG - Intronic
1142398304 16:89845568-89845590 GAGGGTCCCCGTGGTGCTTCCGG + Intronic
1203086890 16_KI270728v1_random:1189302-1189324 CAGGAGCCCCCTGCTCCACCCGG - Intergenic
1142539120 17:643859-643881 CAAGTTCCTCCTGGGCCTCCTGG - Intronic
1142863526 17:2777315-2777337 CAGGGTCCTCCTGGGGTTCCTGG - Intronic
1142888517 17:2928380-2928402 GAGGGTGCCCCTGGTCCTCCTGG - Intronic
1143625030 17:8104759-8104781 CAAGGCCCCTCTTGTCCTCCAGG - Intronic
1144629152 17:16861581-16861603 CACGGACCCCTTGGTCATCCAGG - Intergenic
1144652266 17:17014533-17014555 CACGGACCCCTTGGTCATCCAGG + Intergenic
1145761937 17:27430192-27430214 CAGGGTCCCCTTGGGCTCCCTGG - Intergenic
1145813698 17:27780840-27780862 TGTGGTCCCCCTGGTCCTGCAGG - Exonic
1145834225 17:27941795-27941817 CTGAATCCCCCTGGTCCTGCAGG + Intergenic
1146183492 17:30710884-30710906 CAGGGCCCCCCTCTTCCGCCTGG + Intergenic
1147144522 17:38477443-38477465 CAGGAGCCCCCTGCTCCACCCGG - Intronic
1147605841 17:41773299-41773321 CAGTGCCGCCCTGGCCCTCCAGG + Intronic
1148772177 17:50073873-50073895 CAGGGTCACCCAGGTACTCTGGG - Intronic
1148793591 17:50186903-50186925 CAGGGTCCCCCCGGCCCTCCTGG - Exonic
1148793643 17:50187103-50187125 CAGGGTCCCCCTGGCTCTGCTGG - Exonic
1148793886 17:50188130-50188152 CAGGGTCCTGCTGGTCCCGCCGG - Exonic
1148794170 17:50189256-50189278 AAGGGTGCTCCTGGTACTCCCGG - Exonic
1148794207 17:50189411-50189433 CCTGGTCCCCCTGGCCCTGCTGG - Exonic
1148794212 17:50189420-50189442 GTTGGTCCCCCTGGTCCCCCTGG - Exonic
1148794809 17:50191831-50191853 CAAGGTCCCCCTGGTCCTGCTGG - Exonic
1148794947 17:50192500-50192522 CCTGGTCCTGCTGGTCCTCCAGG - Exonic
1148794950 17:50192509-50192531 CAGGGTCTCCCTGGTCCTGCTGG - Exonic
1148795475 17:50194791-50194813 CAAGGACCCCCTGGCCCTGCTGG - Exonic
1148795555 17:50195081-50195103 CAGGGTGAACCTGGTGCTCCTGG - Exonic
1148796132 17:50197748-50197770 CGAGGTCCCCCAGGTCCCCCTGG - Exonic
1148796173 17:50197965-50197987 CAAGGTCCCCCTGGTGAGCCTGG - Exonic
1148796219 17:50198186-50198208 TAGGGTCCCTCTGGTCCTCGTGG - Exonic
1149988678 17:61368058-61368080 CAGGGTTCCCCTGGTCTTCAGGG - Intronic
1150222935 17:63507506-63507528 AAGGGTCCCACTTGACCTCCAGG - Intronic
1150827532 17:68490199-68490221 CAGGGTCCCTTTGGCCCTCTGGG + Intergenic
1151876632 17:76870688-76870710 CAGGGTCTCCCTGGGCTGCCCGG + Intronic
1152218632 17:79048840-79048862 CAGGGACCCCTGGGTCCCCCAGG + Exonic
1152272323 17:79331914-79331936 CAGGGCCAGCCTGGTCCTCTTGG + Intronic
1152386966 17:79980503-79980525 CAGGGTCCTCCAGGGCCTGCGGG - Intronic
1152410163 17:80119083-80119105 CGGGGTCCCCCTGCGCCTGCCGG + Intergenic
1152477691 17:80528755-80528777 GAGGGGCTCCCCGGTCCTCCCGG + Intergenic
1152575963 17:81141028-81141050 CACGGTCCCCATGGTCCCCACGG - Intronic
1152834533 17:82520426-82520448 CTGGGTCCCGCTGGTGGTCCCGG - Intronic
1152987638 18:334807-334829 AAGGGCCCCCCCGGCCCTCCTGG - Exonic
1152987767 18:335167-335189 CAGGGACCCCCTGGCCCAACTGG - Exonic
1155552156 18:26975977-26975999 CTGGGTCCTCCTTGTTCTCCTGG - Intronic
1157590972 18:48836319-48836341 CAGGGTCCCCATGCTCAGCCTGG + Intronic
1158222421 18:55163305-55163327 CAGGGTCACCCTTGTCACCCAGG - Intergenic
1158292228 18:55955103-55955125 CAGGGCCCCACTGTTCCGCCAGG + Intergenic
1160018860 18:75165075-75165097 CAGGGTACCCCAGCTCCTACAGG - Intergenic
1160196262 18:76758182-76758204 CCAGGTCCCCCTGCTCCTCTCGG + Intergenic
1160265263 18:77336407-77336429 CAGGGTCCCCCAGATAATCCAGG - Intergenic
1160594649 18:79964997-79965019 CAGGGTCCCCCAGGTCTTCAGGG - Intronic
1161001974 19:1915121-1915143 CAGTGTCCTCCTGGCCCACCTGG + Intronic
1161032095 19:2062223-2062245 GTTGGTCCCCCAGGTCCTCCAGG + Intergenic
1161222394 19:3123628-3123650 CTGGGTCCCCCGGCTCCCCCAGG + Exonic
1161376397 19:3941208-3941230 CAGGGTCCCCCCCGCCCGCCCGG - Intronic
1161377476 19:3947348-3947370 CAGGGTCCCGCCAGTCCCCCAGG + Intergenic
1161785733 19:6324423-6324445 CAAGGTCCCCCAGGTCCTGGAGG - Intronic
1161801046 19:6416860-6416882 AGTGGTCCCCCAGGTCCTCCAGG - Exonic
1162013801 19:7832795-7832817 CCTGTTCCCCGTGGTCCTCCTGG - Intronic
1162320377 19:9968060-9968082 TAGGGTCCCCCTGGTCCCATTGG - Exonic
1162320460 19:9968392-9968414 CAGGGACCCCCTGGTCCCAAGGG - Exonic
1162321033 19:9970656-9970678 CAGGGTCCGCCTGGAGCTTCTGG - Exonic
1162321607 19:9973953-9973975 CAGGGTCCCCATGGAGCTCCAGG - Exonic
1162322676 19:9979175-9979197 CCAGGCCCCCCTGGACCTCCTGG - Exonic
1162324276 19:9989503-9989525 CAGGGTCCCCCTGGAAACCCAGG - Exonic
1162341406 19:10093505-10093527 CACGGCCCCCCCAGTCCTCCAGG + Exonic
1162672077 19:12266105-12266127 CAGGGTGGCCCTGGTCCGGCCGG - Intronic
1163690186 19:18734491-18734513 CAGGGTCCCCCATGTTGTCCAGG - Intronic
1163712816 19:18856990-18857012 CATGGTTCCCGTGGTCCTCGGGG + Exonic
1165421390 19:35723782-35723804 GAGGCCTCCCCTGGTCCTCCAGG + Exonic
1166136998 19:40783756-40783778 CTGGGTCCCCCTGGCCCCACAGG + Exonic
1166333362 19:42091279-42091301 TCGGGCCCCCCTGGACCTCCAGG + Exonic
1166379472 19:42348365-42348387 CCTGGTCCACCTGGCCCTCCAGG - Exonic
1166995117 19:46716417-46716439 CAGGGTCCCCCGGGGCCCCCCGG - Exonic
1166996790 19:46723240-46723262 CGGCGTCCCCGTGGCCCTCCAGG + Exonic
1167159587 19:47758331-47758353 CAGGGTCCTCTTTGTCATCCAGG - Intergenic
1167290042 19:48619513-48619535 CTGGGCCCGCCGGGTCCTCCGGG - Exonic
1167306652 19:48713719-48713741 CAGGCTCCACCTGATCCTCCAGG + Exonic
1167381713 19:49142176-49142198 TAGGGGCTGCCTGGTCCTCCTGG + Intronic
1167457477 19:49604875-49604897 CAGGGTCTCCCTTGTTGTCCAGG + Intronic
1167743273 19:51337364-51337386 CTGGGTCTCCCTGCTCATCCTGG - Exonic
1168134035 19:54338573-54338595 GACGGTACCCCTGGGCCTCCAGG + Exonic
1168320747 19:55508118-55508140 CAGGCGCTCCCTGGACCTCCAGG - Intronic
1202647782 1_KI270706v1_random:157702-157724 CAGGGTCGCCAGGGTCCACCAGG - Intergenic
1202709034 1_KI270714v1_random:6428-6450 CAGGGTGACCCTGGGCCTCCAGG - Intergenic
925140631 2:1547488-1547510 CAGGCTCCCCCAGGTGGTCCAGG + Intergenic
925748866 2:7069231-7069253 CACGGTCCTCCTGGTCATGCAGG - Intergenic
925858516 2:8153102-8153124 TGGGGTCCCCCTGGTCCTCAGGG + Intergenic
927200352 2:20574552-20574574 CAGTGATCCCCTGGCCCTCCAGG - Intronic
927702614 2:25277442-25277464 CAGGGTCCGCCGGGACCGCCAGG - Intronic
927892893 2:26763607-26763629 CAGGGTCCCCAAGGAACTCCCGG + Intergenic
927927378 2:27023501-27023523 CAGGGTCACACTGCTCCTCAGGG - Intronic
927937622 2:27084456-27084478 CAGGGACCCCCAGGCCCTGCTGG + Exonic
929579754 2:43074353-43074375 CAGTGTCCTCCTTTTCCTCCTGG - Intergenic
929924947 2:46200379-46200401 CAGGATGCCCCTGGACCTGCTGG - Intergenic
931422737 2:62143222-62143244 CAGGGTCAGCCTGGGGCTCCAGG - Intronic
931695215 2:64865827-64865849 AGGGGTCTCCCTGGCCCTCCCGG - Intergenic
932187228 2:69708628-69708650 CAGGGACCTGCTGGTCCTGCAGG - Intronic
932667380 2:73708311-73708333 CATGTGCCCCCTGGTCCCCCTGG + Intergenic
934717047 2:96550348-96550370 CAGAGTCCACCCGGCCCTCCCGG - Intronic
934749444 2:96783395-96783417 CTGGGACCCCCTGCACCTCCTGG + Intronic
934779983 2:96963794-96963816 CAGAGACCACCTGGTCCTCAAGG + Intronic
935217822 2:100988711-100988733 CAGGTGCCCCCTGCTCCTCCAGG + Intronic
935217829 2:100988730-100988752 CAGGCGCCCCCTGCTCCTCCAGG + Intronic
935217836 2:100988749-100988771 CAGGCCCCCACTGCTCCTCCAGG + Intronic
935217843 2:100988767-100988789 CCAGGTCTCCCTGCTCCTCCAGG + Intronic
935217855 2:100988804-100988826 CCAGGTCTCCCTGCTCCTCCAGG + Intronic
935217860 2:100988822-100988844 CCAGGTCCCCCTGCTCCTCCAGG + Intronic
935217867 2:100988841-100988863 CAGGCCCCCACTGCTCCTCCAGG + Intronic
935217878 2:100988878-100988900 CAGGCGCCCCCTGCCCCTCCAGG + Intronic
935217887 2:100988897-100988919 CAGGCCCCCACTGTTCCTCCAGG + Intronic
935217894 2:100988915-100988937 CCAGGTCCCCCTGCTCCTCCAGG + Intronic
935217907 2:100988952-100988974 CAGGCGCCCCCTGCTCCTCCAGG + Intronic
935217914 2:100988970-100988992 CCAGGCCCCCCTGCTCCTCCAGG + Intronic
935217922 2:100988989-100989011 CAGGCCCCCACTGCTCCTCCAGG + Intronic
935261745 2:101361850-101361872 CAGGGTCCCCAGGGTGCTCAGGG - Intronic
936563535 2:113563247-113563269 AACTCTCCCCCTGGTCCTCCAGG - Intergenic
936913428 2:117615560-117615582 CAGTTTCCCCCTGGTGGTCCAGG - Intergenic
937215400 2:120309640-120309662 CAGGGTCTCACTTGTCATCCAGG + Intergenic
937259639 2:120577173-120577195 CAGGGACCCCCGGGACCCCCAGG + Intergenic
937999353 2:127719881-127719903 CAGGGTCCACCTGGCCCACAGGG - Exonic
938307733 2:130266408-130266430 CAGGGTCCATCTGGACCTCAGGG + Intergenic
938308288 2:130268890-130268912 CAGGGTCAGCCGGGTCCTCGAGG + Intergenic
938310544 2:130285969-130285991 CAGGGTCTTCCTGGCCCTCAGGG + Intergenic
938444382 2:131366398-131366420 CAGGGTCTTCCTGGCCCTCAGGG - Intergenic
938447041 2:131387946-131387968 CAGGGTCAGCCGGGTCCTCGAGG - Intergenic
938902052 2:135806874-135806896 CAGGCTCCCCCTGCTCCATCTGG + Intronic
941320711 2:164050597-164050619 GAGGTTCACCCTGGTCCTCCTGG + Intergenic
943523594 2:188988078-188988100 CAGGGCCCCCCAGGCCCTCCCGG + Exonic
943523684 2:188989393-188989415 CAGGGCCCTCCAGGACCTCCTGG + Exonic
943523901 2:188992884-188992906 CAGGGCCCTCCTGGTCCTCCTGG + Exonic
943524499 2:188999467-188999489 CAGGGTGCTGCTGGTCCTCCTGG + Exonic
943524817 2:189003408-189003430 TAGGGTCCTCCTGGTCCCCAAGG + Exonic
943524848 2:189003758-189003780 CGTGGTCTTCCTGGTCCTCCTGG + Exonic
943528229 2:189045843-189045865 CAGGGTGCCCCTGGAACTCCTGG - Exonic
943529447 2:189060764-189060786 TAGGGGCTTCCTGGTCCTCCAGG - Exonic
943530016 2:189068031-189068053 CAGGGTAGCACTGGTCCTCAGGG - Exonic
943530032 2:189068085-189068107 CCAGGTACCTCTGGTCCTCCTGG - Exonic
943966630 2:194342339-194342361 TAACTTCCCCCTGGTCCTCCTGG + Intergenic
946220032 2:218217800-218217822 CAGGGTCCCCCACGTCCCACAGG - Intronic
947142256 2:227030496-227030518 CCAGGTCCCCCTGGCCCACCAGG - Exonic
947142438 2:227031953-227031975 CAGGGACCTCCTGGTCCTGATGG - Exonic
947148348 2:227088759-227088781 ATGGGCCCCCCTGGCCCTCCAGG - Exonic
947151321 2:227118742-227118764 CAGGGGCACCCAGGGCCTCCTGG - Exonic
947151524 2:227121129-227121151 CAGGGTCCACCAGGACCACCAGG - Exonic
947169670 2:227298687-227298709 CCTGGTCCCCCTGGACCTCCAGG + Exonic
947531269 2:230910026-230910048 CAGGGTCCAGCTGGTCCTGCAGG - Exonic
947876390 2:233470644-233470666 AAGGATGCCCCTGGTCCTCCAGG + Exonic
948352511 2:237352565-237352587 CAGGGCCCAGCTGGTCCTGCTGG - Exonic
948468339 2:238162745-238162767 CCAGGGCCCCCTGGGCCTCCCGG + Exonic
948587675 2:239029406-239029428 GAGGCTCCCCTGGGTCCTCCAGG - Intergenic
948897509 2:240934201-240934223 CAGGGACTCCATGCTCCTCCTGG + Intronic
1168859297 20:1034457-1034479 CAGTTTCCACCTGGTTCTCCTGG + Intergenic
1168953822 20:1820333-1820355 AATGGTCCTCGTGGTCCTCCTGG + Intergenic
1169146385 20:3255246-3255268 CAGCATCCCCCTGGTCTTCAGGG + Exonic
1169200210 20:3705612-3705634 CAGGCTGCTCCTGGGCCTCCAGG - Intronic
1170423720 20:16217641-16217663 AAGGGTCCCCCAGATCCTCTTGG + Intergenic
1170572619 20:17641049-17641071 GAGGGGCCCCCTGGCCCTCTGGG - Intronic
1171298561 20:24039854-24039876 CCGGGTCCCCTTGGTCCTAGGGG + Intergenic
1171938211 20:31296604-31296626 CAGTGTCCCACTGGTCATTCAGG - Intergenic
1172060556 20:32184418-32184440 CAGGCTCACCCTGATCCCCCCGG + Intergenic
1172586988 20:36092296-36092318 CCGGGGCCCCCACGTCCTCCCGG - Intronic
1173179490 20:40793772-40793794 CAGGGTCTCCCCTGTCATCCAGG + Intergenic
1174461843 20:50688864-50688886 CAGGGTCCCCCAGTTCATCCTGG - Intronic
1175440824 20:58989920-58989942 CGGAGCCCCCCTGCTCCTCCTGG - Exonic
1175466775 20:59194674-59194696 GAGGGTCCCAATGGCCCTCCTGG + Exonic
1175790104 20:61735550-61735572 CAGGGTCCCTGTGGCCCCCCAGG - Intronic
1175874908 20:62224748-62224770 AAGCGTCCCCCAGGCCCTCCTGG - Intergenic
1175981034 20:62738736-62738758 CAGGCTCACGCTGGTCCTCGAGG + Intronic
1175998613 20:62822135-62822157 CCTGGTCCCCCAGGACCTCCCGG + Exonic
1175999546 20:62825814-62825836 CAGGGTGACCCTGGCCCCCCTGG + Exonic
1176157075 20:63627250-63627272 CAGGTTCCTCCTGGTCCCCGAGG + Intergenic
1176429342 21:6566573-6566595 CTGGGGCTCCCTGCTCCTCCTGG + Intergenic
1176604067 21:8815024-8815046 CAGGGTCGCCAGGGTCCACCAGG + Intergenic
1179084411 21:38204659-38204681 CAGGGGACCCCTGGTCCTTGTGG + Intronic
1179176626 21:39012261-39012283 CAGGGTCCCTCTGACCCACCTGG - Intergenic
1179704734 21:43174035-43174057 CTGGGGCTCCCTGCTCCTCCTGG + Intergenic
1179826269 21:43968197-43968219 CAGGGACCCCCTGCTCACCCCGG - Intronic
1180079025 21:45477909-45477931 CAAGGACCCCCAGGGCCTCCGGG + Exonic
1180079905 21:45481960-45481982 CAGGGACCCCCAGGCCCTCCGGG + Exonic
1180085262 21:45505378-45505400 CCGGGCCCCCCTGGGCCCCCTGG + Exonic
1180346351 22:11706602-11706624 CAGGGTCGCCAGGGTCCACCAGG + Intergenic
1180354124 22:11824760-11824782 CAGGGTCCCCAGTGTCCACCAGG + Intergenic
1180384119 22:12167566-12167588 CAGGGTCGCCAGGGTCCACCAGG - Intergenic
1180729600 22:17971770-17971792 AAGGGGCCCCCTGGCCCTTCAGG + Intronic
1180919592 22:19514467-19514489 CAGAGTCCTCCTGGGCCTTCAGG + Intronic
1180954468 22:19735484-19735506 CAGTGTCCTCCTGGGCCTCCTGG + Intergenic
1181091110 22:20473188-20473210 CAGGGTCACCCTTGGCCTCCAGG - Intronic
1181182431 22:21077552-21077574 CACGGCACCCCTGATCCTCCTGG + Intergenic
1181397833 22:22634166-22634188 CAGAGACCCCCTCGTCGTCCTGG - Intergenic
1181500578 22:23313536-23313558 CAGAGACCCCCTCGTCGTCCTGG - Intronic
1181651576 22:24261892-24261914 CAGAGACCCCCTTGTCGTCCTGG + Intergenic
1181705799 22:24648847-24648869 CAGAGACCCCCTCGTCGTCCTGG - Intergenic
1182061631 22:27402569-27402591 CAGAGTCTCCGTGGTCCTCCTGG - Intergenic
1182284009 22:29233429-29233451 CAGGGACCCACTGGGCCTCCAGG + Exonic
1182284055 22:29233610-29233632 CCAGGTCCCCCTGGGCCTCCTGG + Exonic
1182293324 22:29298744-29298766 ATGGGTCCCCCAGGACCTCCTGG - Exonic
1182422208 22:30254079-30254101 TTGGGTCCCCCTAGACCTCCAGG + Intergenic
1183063879 22:35350753-35350775 CAGGGTCCCCCTGGCGTTCCTGG + Intergenic
1183345091 22:37303134-37303156 GAAGGTCCACCTTGTCCTCCTGG - Intronic
1184198505 22:42948160-42948182 CAGGGTCCCGCTGGTCCTGGAGG + Intronic
1184583856 22:45434644-45434666 CAGGCTCCCACTGGGCCTCTTGG + Intergenic
1184717214 22:46289021-46289043 CAGGGCAGCCCAGGTCCTCCAGG - Intronic
1185039007 22:48494974-48494996 CTGGAATCCCCTGGTCCTCCTGG + Intronic
1185218603 22:49617480-49617502 CTGGGTCCTCCTGGGCCTCTGGG + Intronic
1185275245 22:49947860-49947882 CAGGCTCCCTCCTGTCCTCCGGG + Intergenic
1203275353 22_KI270734v1_random:82677-82699 CAGAGACCCCCTCGTCGTCCTGG + Intergenic
950524901 3:13517862-13517884 CTGGGTCCTGCTGCTCCTCCTGG - Intergenic
950666348 3:14497601-14497623 CAGGGGCTCCCTGCTGCTCCTGG - Intronic
950751863 3:15135491-15135513 CATGGTCACCCTGGCCCTGCTGG + Intergenic
952064094 3:29546999-29547021 CAGGGTCCCACTGGTCACCCAGG + Intronic
952216932 3:31287451-31287473 GGGGGACCCCCTGCTCCTCCAGG + Intergenic
953882803 3:46700392-46700414 CAGGGTCTCCCTGGTTCTCAGGG + Intergenic
954133410 3:48571117-48571139 CCGGGCTCCCCTGGGCCTCCTGG - Exonic
954135416 3:48580038-48580060 CAGGGTCCCCCAGGACCCCCGGG - Exonic
954136480 3:48584356-48584378 CAGGGCCCCCCTGGACCTCGTGG - Exonic
954365537 3:50144260-50144282 CGGGGTTCTCCTGGTCCTTCTGG - Intergenic
955047206 3:55371869-55371891 GGGGCTCCCACTGGTCCTCCCGG + Intergenic
957068750 3:75548813-75548835 CATGGTCACCCTGGCCCTGCTGG - Intergenic
961301502 3:125925030-125925052 CAGGAGCCCGCTGGTGCTCCCGG - Intergenic
961457023 3:127029383-127029405 CAGGGTGCCCCTGCACCACCAGG - Intronic
961790470 3:129372479-129372501 CAGGGTCTCCCTGGTTGTCCAGG + Intergenic
962890314 3:139666295-139666317 CAGCTCCCACCTGGTCCTCCAGG + Intronic
964320872 3:155495664-155495686 CAGGGCCCCTGTGGTCCTCAGGG + Intronic
966007748 3:175037189-175037211 CAGCTTCCCACTTGTCCTCCAGG + Intronic
966735304 3:183182341-183182363 CAGGCCCCCCGTGGTGCTCCAGG - Intronic
967171079 3:186824404-186824426 CAGGACCCCCATGGTGCTCCAGG + Intergenic
967191600 3:186989837-186989859 CAGGGACCCTGTGGACCTCCTGG + Intronic
968151256 3:196338389-196338411 CAGAGCCTCCCTGGCCCTCCTGG - Intronic
968439110 4:612656-612678 CAGGCTCCTGCTGGTCTTCCTGG - Intergenic
968534161 4:1113156-1113178 CAGAGTTCCCCTGCTCCTCGCGG + Intronic
968580038 4:1385529-1385551 CAGCCTCCCCCTTGGCCTCCCGG - Intronic
968728396 4:2258758-2258780 CAGTGTCCCCCTGTGCCTACTGG - Intronic
968996119 4:3946831-3946853 CAGGAGCCCGCTGGTGCTCCCGG + Intergenic
969013078 4:4083350-4083372 CATGGTCACCCTGGCCCTGCCGG - Intergenic
969513003 4:7630270-7630292 TAGGGTCTCCCAGGTGCTCCTGG - Intronic
969740765 4:9024440-9024462 CATGGTCACCCTGGCCCTGCTGG + Intergenic
969817847 4:9699409-9699431 CAGGAGCCCGCTGGTGCTCCCGG - Intergenic
970321178 4:14877128-14877150 AAGGGTCCCCCTGGTCCATGAGG + Intergenic
970909919 4:21263001-21263023 CCTGGTCCCCCTGTTCATCCAGG + Intronic
971029920 4:22624795-22624817 CTGGGTCCTCCTTGTTCTCCTGG - Intergenic
973374048 4:49275892-49275914 CAGGGTCGCCAGGGTCCACCAGG - Intergenic
973383364 4:49334347-49334369 CAGGGTCGCCAGGGTCCACCAGG + Intergenic
973386971 4:49519361-49519383 CAGGGTCGCCAGGGTCCACCAGG + Intergenic
975538945 4:75484185-75484207 CTGGGTCCCCTTGGTGCTCCTGG - Intronic
976969968 4:91092487-91092509 CAAGGCCCCTCTGTTCCTCCTGG - Intronic
978452649 4:108852261-108852283 TAGGGTCCCCCTGGACCTCCTGG - Exonic
978459965 4:108940600-108940622 CCAGGACCCCCTGGCCCTCCAGG - Exonic
979251733 4:118573088-118573110 CAGGGTCAGCCTGGTCCTAAGGG + Intergenic
981920387 4:150079101-150079123 GAGGGGCCCCCAGCTCCTCCGGG + Exonic
983674379 4:170275185-170275207 CAGGATCCTCCAGATCCTCCGGG + Intergenic
984364697 4:178783686-178783708 CAGGATCCTCCTGGTTCTCAAGG + Intergenic
985619519 5:946819-946841 TGGGGTCCCCTTGGTCCACCAGG + Intergenic
985882909 5:2654023-2654045 CCGGGTCCCCCTCGTCTTCCAGG + Intergenic
986292510 5:6411437-6411459 CAGGGTCCAGCTGACCCTCCTGG - Intergenic
988737350 5:34035664-34035686 CAAGGCCCCCCTGGGCCACCGGG - Exonic
989581204 5:43034708-43034730 CAGGGTCCCCGTGATAGTCCTGG - Intergenic
997438744 5:133893646-133893668 CAGGGTTCCCTTGGCCCTCTGGG - Intergenic
998175296 5:139898134-139898156 CAGGGCCTCCCTGGTCCCCAAGG - Intronic
998850483 5:146346159-146346181 CAGGGTTCGCCCGCTCCTCCCGG + Intergenic
999432885 5:151539041-151539063 CAGGCTCACCCTGGCCCTCCCGG - Intronic
999721323 5:154401102-154401124 CAGGGTCACCCTGGTCCCTCAGG + Intronic
1001269506 5:170300950-170300972 CAGGGTCACAGTGGTCCTTCTGG - Intergenic
1001528335 5:172444927-172444949 CAGGAGCCCCCAGGTCCTTCTGG + Intronic
1001772791 5:174308595-174308617 CTGGGTCCCCCTGGTTAACCCGG + Intergenic
1002070083 5:176673991-176674013 CAGGGGACCCCTGGAGCTCCAGG + Intergenic
1002299991 5:178252560-178252582 CAGGGGCCCCCAGGGCCACCAGG - Exonic
1002302158 5:178263269-178263291 CCGGGGCCCCCTGGACCTCCTGG - Exonic
1002879397 6:1238082-1238104 CGGGGTCTCCCTGGCCCCCCAGG - Intergenic
1003569354 6:7246243-7246265 CAGGGTCATCTTGGTCCTCCTGG + Intronic
1004147053 6:13077693-13077715 CAGGCTCCCCCTGTTCCTGTTGG - Intronic
1004349681 6:14880261-14880283 CAAGGGCTCCCTGGTCCTGCAGG - Intergenic
1006295989 6:33170360-33170382 CAGGGACCACCTGGCCCCCCAGG - Exonic
1006296206 6:33171148-33171170 CAGGGCCCTCCTGGACCCCCTGG - Exonic
1006296352 6:33171729-33171751 CAGGGTCCCCCTGGAGCAGCAGG - Exonic
1006296524 6:33172359-33172381 TAGGGTGACCCTGGTCCCCCTGG - Exonic
1006296710 6:33173076-33173098 ACCGGCCCCCCTGGTCCTCCAGG - Exonic
1006297505 6:33176467-33176489 CAGGGTCCCTCTGGACCTCAGGG - Exonic
1006297970 6:33178451-33178473 CAGGGCCTTCCTGGTCCCCCTGG - Exonic
1007341670 6:41194583-41194605 CTGGGACCCCATGGTCCTCCTGG + Exonic
1007652575 6:43432554-43432576 CAGGGTTCTCGTGGTCCCCCAGG - Exonic
1008853976 6:56059164-56059186 CAAGGTCCTCCTGGTCCCCCAGG - Exonic
1009935724 6:70232600-70232622 AAGGGGCCCCCTGGTGCTCTTGG - Exonic
1009935749 6:70232672-70232694 CCTGGTCCCCCCGGCCCTCCTGG - Exonic
1009940193 6:70281424-70281446 CAGGGTCCTCCCGGGCCTCCGGG - Exonic
1010369149 6:75087633-75087655 CGAGGACCCCCAGGTCCTCCTGG - Exonic
1010369460 6:75090199-75090221 CCGGGTCCACCGGGACCTCCTGG - Exonic
1010370592 6:75102628-75102650 CAGGGTCCTCCAGGCCCTCAGGG - Exonic
1010370610 6:75102673-75102695 TAGGGGCCCCCTGGTCCTCGTGG - Exonic
1012400132 6:98835609-98835631 CAGGGTCCGCCTGGCCACCCAGG + Exonic
1013980123 6:116120575-116120597 CCAGGGCCCCCTGGGCCTCCAGG - Exonic
1013980517 6:116121919-116121941 CAAGGTACTCCTGGTCCACCAGG - Exonic
1016969630 6:149750009-149750031 CCGGGTCCCCCTGGGCCGTCCGG + Intronic
1017266792 6:152455449-152455471 CTGGATCCCCCTTTTCCTCCAGG + Exonic
1018032310 6:159851173-159851195 CTGGGTCCCCTTGGCCCTGCAGG - Intergenic
1018141086 6:160837796-160837818 CAGGGTCGCCCGGCTCCCCCGGG + Intergenic
1018818016 6:167350507-167350529 CAGGGTCCCCCGGCTCCCCCGGG - Intronic
1018839286 6:167507143-167507165 CAGGGTCCCGCAGAGCCTCCCGG + Intergenic
1018892078 6:167989725-167989747 CCAGGTCCTCCTGGCCCTCCCGG + Intergenic
1019037998 6:169078303-169078325 GATGGTCCTCCTGGTCCTCCTGG - Intergenic
1019299519 7:296267-296289 CTGGCACCTCCTGGTCCTCCTGG + Intergenic
1019645083 7:2124691-2124713 CAGGGTGGGCCTGGCCCTCCCGG - Intronic
1020077668 7:5269144-5269166 CAGGGTCTACATGGTCATCCTGG + Intergenic
1020375140 7:7477161-7477183 CAGGGTCCCCGTGGTCCTGAGGG - Exonic
1020376244 7:7490627-7490649 CAGGGTGAGCCAGGTCCTCCTGG - Exonic
1021780946 7:24105332-24105354 CAGGGTTCCCCTGGTCGACCTGG + Intergenic
1023742330 7:43292011-43292033 CAGGGTCACCCTTCTCTTCCTGG + Intronic
1023752593 7:43386357-43386379 AAGGGTCCCCCTAGTCATCCTGG + Intronic
1024418147 7:49132247-49132269 CTGGGTCCCCTCAGTCCTCCAGG - Intergenic
1025035505 7:55590652-55590674 CAGGGCCCTCCTGGACCCCCTGG + Intergenic
1025201465 7:56964540-56964562 CAGGGTCTACGTGGTCATCCCGG - Intergenic
1025670480 7:63612392-63612414 CAGGGTCTACGTGGTCATCCCGG + Intergenic
1025984248 7:66433942-66433964 CTTGTTCCCCCTCGTCCTCCAGG + Intergenic
1028752763 7:94400193-94400215 CAGGGTCCACCAGGCCCCCCAGG + Exonic
1028752781 7:94400247-94400269 CCTGGTCCACCTGGTCCTCCTGG + Exonic
1028753998 7:94413918-94413940 CAGGGTCCCCCTGGTCCTCCAGG + Exonic
1028754613 7:94421015-94421037 AATGGTCCCCCCGGTCCTGCTGG + Exonic
1028754818 7:94422972-94422994 CCTGGTCCCCCTGGTCCTGCTGG + Exonic
1028754994 7:94424360-94424382 CAGGGTCTTCTTGGTGCTCCTGG + Exonic
1028755186 7:94425995-94426017 CAGGGTCCTTCTGGTCCTGTTGG + Exonic
1028755365 7:94427624-94427646 CAGGGCCCCCCTGGTCCCCCTGG + Exonic
1028755371 7:94427633-94427655 CCTGGTCCCCCTGGCCCTCCTGG + Exonic
1029045289 7:97621428-97621450 CAGGCTCAGCCTGGTCCTGCAGG + Intergenic
1029114113 7:98228689-98228711 CAGGGTCCCTCTGTTCCTACTGG - Intronic
1029434517 7:100555068-100555090 CAGGGGCACCCAGGGCCTCCAGG - Intronic
1029597877 7:101547218-101547240 CGGGGTCCCCCTGGTCCACCAGG + Exonic
1034277972 7:149832049-149832071 CAGGCGCGCCCTGGACCTCCTGG + Intergenic
1035642020 8:1191024-1191046 CAGGGTCATCCTGGACCTGCTGG - Intergenic
1035712572 8:1729792-1729814 AAGGGCCTCCCTGGTCCTTCGGG + Intergenic
1036210188 8:6834980-6835002 CAGGGTCCCCCTGGACGGCCGGG + Intronic
1036245970 8:7117007-7117029 CATGGTCACCCTGGCCCTGCTGG + Intergenic
1036522020 8:9500680-9500702 CAGAGTCTCCCTGGTCACCCAGG - Intergenic
1036888300 8:12577020-12577042 CATGGTCACCCTGGCCCTGCTGG - Intergenic
1038455830 8:27671292-27671314 CAGGGTCCCCCTGGTCTCCCGGG + Exonic
1039449503 8:37660509-37660531 CCAGGTCCCCCTGGCTCTCCAGG + Intergenic
1043012730 8:74900833-74900855 CAGGGTCCCTTTGGCCCTCAGGG - Intergenic
1044822019 8:96161115-96161137 CAGGGTCCCCCTCGAACTCCCGG + Intergenic
1046978838 8:120313974-120313996 CAGGGTCCACCTGGACCTCAAGG + Exonic
1047498016 8:125422361-125422383 CAGGCCCTCGCTGGTCCTCCAGG + Intergenic
1047827717 8:128595617-128595639 CCAGATCCCCCAGGTCCTCCTGG + Intergenic
1048865130 8:138755164-138755186 CAAGGCGCCCCCGGTCCTCCAGG - Exonic
1049585970 8:143432518-143432540 CAGTGTGCCCCAGGGCCTCCAGG - Intergenic
1049671134 8:143870361-143870383 CAGGGTGGCCCTGGCCCTGCTGG - Exonic
1049889196 9:52481-52503 AACTCTCCCCCTGGTCCTCCAGG + Intergenic
1052063608 9:23990263-23990285 CATTGTCCCACTGGTCATCCAGG - Intergenic
1053295650 9:36911235-36911257 CAGGGGCACCATGGTACTCCCGG + Intronic
1053730681 9:41053766-41053788 AACTCTCCCCCTGGTCCTCCAGG + Intergenic
1054350886 9:64016179-64016201 CAGGGTCGCCAGGGTCCACCGGG + Intergenic
1054697820 9:68378310-68378332 AACTCTCCCCCTGGTCCTCCAGG - Exonic
1056461961 9:86817305-86817327 CAGGGTCTCCTTGGGCCTCTGGG - Intergenic
1056600670 9:88044277-88044299 CAGGATCCCCATTTTCCTCCAGG - Intergenic
1057123707 9:92599934-92599956 GTGGGTCCCACTGGTCCCCCAGG - Intronic
1057916080 9:99056290-99056312 CAAGGACCCCCAGGTGCTCCTGG + Exonic
1057916517 9:99059900-99059922 CCAGGTCCCCCTGGCCCTCCAGG + Exonic
1059418763 9:114178288-114178310 CAGGGTCCCCCTGGGCTACCTGG + Exonic
1059419624 9:114183019-114183041 CAGGGTCCTCCTGGGCCTTATGG + Exonic
1059438086 9:114288482-114288504 GAGGGGCCCCCTGGGCCACCTGG + Exonic
1059529937 9:115026627-115026649 CATGGTCCCGCAGGTCCACCCGG + Exonic
1060434458 9:123581699-123581721 CAGGGTGCCACTGGGCCTTCTGG + Intronic
1060733569 9:126052451-126052473 CAGGGCTCACCTGGTCCTCAAGG - Intergenic
1061404256 9:130384891-130384913 CAGCCTCCCCCTGTGCCTCCTGG - Intronic
1061425632 9:130496685-130496707 CAGGGCCCTCCTGCCCCTCCAGG - Intronic
1061714311 9:132509399-132509421 CAGGGGTCCCCTGCTCCTCAAGG + Intronic
1061866385 9:133493693-133493715 CAGGGCCCTGCTGGTCCTTCAGG - Intergenic
1061940814 9:133882894-133882916 CAGAGTCCCTCTTGTCCTCCTGG - Intronic
1062105004 9:134750539-134750561 CAGGGCCCCCCTGGACGCCCAGG + Exonic
1062107136 9:134761922-134761944 TAGGGTGACCCTGGTCCTTCCGG + Exonic
1062107892 9:134765705-134765727 AAGGGGCCCCCAGGTCCTCCCGG + Exonic
1062108257 9:134767325-134767347 CAGGGTGCAATTGGTCCTCCAGG + Exonic
1062116358 9:134811336-134811358 CAGGGTCCTCCTGGGCCTACAGG + Exonic
1062116571 9:134812602-134812624 TAGGGCCCCCCGGGTCCCCCTGG + Exonic
1062116577 9:134812611-134812633 CCGGGTCCCCCTGGCCCCCGAGG + Exonic
1062117591 9:134817775-134817797 CAGGGTCCCCCAGGCCCCGCAGG + Exonic
1062117921 9:134818997-134819019 CAGGGTCCCCCAGGACTTCCCGG + Exonic
1062118574 9:134822094-134822116 CAGGGTATCACTGGTCCTTCTGG + Exonic
1062118817 9:134822995-134823017 CAGGGTCCGCCTGGTCCAAAAGG + Exonic
1062129127 9:134883307-134883329 CGTGGCCCCCCTGGACCTCCTGG + Exonic
1062274030 9:135722224-135722246 CAGGGTCTCCCTGGATATCCTGG - Intronic
1062322788 9:135998507-135998529 GAGGCTCCTCCTGCTCCTCCTGG - Intergenic
1062460151 9:136659562-136659584 CAGAGCCCCCCGGGCCCTCCCGG - Exonic
1203551479 Un_KI270743v1:167182-167204 CAGGGTCGCCAGGGTCCACCAGG + Intergenic
1186795587 X:13044236-13044258 CAGGGGTCCCCTGGGCGTCCAGG - Intronic
1189213860 X:39306678-39306700 CAGGGTCTCCCTGTTGCCCCAGG - Intergenic
1189328815 X:40130344-40130366 GAGGTTTCCCCTGGTCTTCCTGG + Intronic
1189354442 X:40300279-40300301 CAGGGTCCGCCTGGGCCTCAGGG + Intergenic
1190336448 X:49265616-49265638 CAGGGTCCCAATGGGCCTCTGGG - Intergenic
1190942796 X:55058878-55058900 CAGGGTCTCCCTGGTGTTTCAGG - Intergenic
1191252121 X:58264725-58264747 CAGGGTCCCCCCGAACCTCGCGG - Intergenic
1191779497 X:64850369-64850391 CCTGGTCCCTCTGGTCCTCATGG + Intergenic
1192312436 X:70027970-70027992 ATGGGACCACCTGGTCCTCCAGG + Exonic
1192312439 X:70027979-70028001 CCTGGTCCTCCAGGTCCTCCTGG + Exonic
1192312442 X:70027988-70028010 CCAGGTCCTCCTGGTCCTCAAGG + Exonic
1193591137 X:83390011-83390033 CTAGGTCACTCTGGTCCTCCTGG + Intergenic
1195756687 X:108205676-108205698 TAGGGTCCTCCAGGGCCTCCTGG - Exonic
1195789590 X:108568626-108568648 TAGGGTCCTCCTGGACTTCCTGG + Exonic
1195790360 X:108577949-108577971 TAGGGCCCTCCTGGTCCACCAGG + Exonic
1195790398 X:108578306-108578328 CAGGGCCCACCTGGGCCACCTGG + Exonic
1195791051 X:108586717-108586739 CAGGGTCCACCTGGCCTTCCTGG + Exonic
1195791323 X:108591069-108591091 ATGGGTCCTCCTGGCCCTCCTGG + Exonic
1195791734 X:108595580-108595602 CCAGGTCTCCCAGGTCCTCCAGG + Exonic
1195797608 X:108668414-108668436 CAGGGTCCCCCAGGCCCTCCTGG + Exonic
1195799141 X:108687523-108687545 CAAGGTCCCCCAGGTCCCCCTGG + Exonic
1196063265 X:111433976-111433998 CAGCTTCCACCTGGTCCTCTTGG - Intergenic
1198242769 X:134801503-134801525 CAGGGACCCTTTGGCCCTCCAGG + Intronic
1198970132 X:142270458-142270480 CAAGGCCCCTCTGTTCCTCCCGG + Intergenic
1199438661 X:147843528-147843550 CAGGGTCTCCCTCTTTCTCCAGG + Intergenic
1199950239 X:152700642-152700664 CCGGGGGCCTCTGGTCCTCCAGG - Exonic
1200057918 X:153471048-153471070 AAGGCTCCCCTTGGTCCTCCTGG - Intronic
1201270400 Y:12248516-12248538 CAAGGCCCCTCTGTTCCTCCTGG + Intergenic
1201680461 Y:16639550-16639572 CAAGGCCCCTCTGTTCCTCCTGG - Intergenic
1201696968 Y:16836770-16836792 CAAGGCCCCTCTGTTCCTCCTGG + Intergenic