ID: 1028759592

View in Genome Browser
Species Human (GRCh38)
Location 7:94480608-94480630
Sequence ATCCTCCATATTTGCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028759585_1028759592 14 Left 1028759585 7:94480571-94480593 CCAGGCTAGTCTCAGCTCCCTGG No data
Right 1028759592 7:94480608-94480630 ATCCTCCATATTTGCAAGCCTGG No data
1028759588_1028759592 -3 Left 1028759588 7:94480588-94480610 CCCTGGTACAGCTCCCTGGTATC No data
Right 1028759592 7:94480608-94480630 ATCCTCCATATTTGCAAGCCTGG No data
1028759584_1028759592 15 Left 1028759584 7:94480570-94480592 CCCAGGCTAGTCTCAGCTCCCTG No data
Right 1028759592 7:94480608-94480630 ATCCTCCATATTTGCAAGCCTGG No data
1028759589_1028759592 -4 Left 1028759589 7:94480589-94480611 CCTGGTACAGCTCCCTGGTATCC No data
Right 1028759592 7:94480608-94480630 ATCCTCCATATTTGCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028759592 Original CRISPR ATCCTCCATATTTGCAAGCC TGG Intergenic
No off target data available for this crispr