ID: 1028762291

View in Genome Browser
Species Human (GRCh38)
Location 7:94509782-94509804
Sequence GAGGCTAAAGAGGAGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2435
Summary {0: 1, 1: 1, 2: 19, 3: 334, 4: 2080}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028762278_1028762291 15 Left 1028762278 7:94509744-94509766 CCGGACCCCCCTCGCAGGCGCAG 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 19
3: 334
4: 2080
1028762283_1028762291 6 Left 1028762283 7:94509753-94509775 CCTCGCAGGCGCAGCCGCTATTA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 19
3: 334
4: 2080
1028762281_1028762291 8 Left 1028762281 7:94509751-94509773 CCCCTCGCAGGCGCAGCCGCTAT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 19
3: 334
4: 2080
1028762287_1028762291 -8 Left 1028762287 7:94509767-94509789 CCGCTATTAAGGCAGGAGGCTAA 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 19
3: 334
4: 2080
1028762280_1028762291 9 Left 1028762280 7:94509750-94509772 CCCCCTCGCAGGCGCAGCCGCTA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 19
3: 334
4: 2080
1028762282_1028762291 7 Left 1028762282 7:94509752-94509774 CCCTCGCAGGCGCAGCCGCTATT 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 19
3: 334
4: 2080
1028762279_1028762291 10 Left 1028762279 7:94509749-94509771 CCCCCCTCGCAGGCGCAGCCGCT 0: 1
1: 0
2: 2
3: 11
4: 269
Right 1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 19
3: 334
4: 2080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028762291 Original CRISPR GAGGCTAAAGAGGAGGAGGA AGG Exonic
Too many off-targets to display for this crispr