ID: 1028762337

View in Genome Browser
Species Human (GRCh38)
Location 7:94509914-94509936
Sequence GTCGGGGGCGCCGCGGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 403}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028762330_1028762337 -3 Left 1028762330 7:94509894-94509916 CCGAGGAGGGGCAGGCGGAGGTC 0: 1
1: 0
2: 1
3: 64
4: 421
Right 1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 3
3: 56
4: 403
1028762320_1028762337 15 Left 1028762320 7:94509876-94509898 CCGCCGAGTCGGCCGCGGCCGAG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 3
3: 56
4: 403
1028762327_1028762337 3 Left 1028762327 7:94509888-94509910 CCGCGGCCGAGGAGGGGCAGGCG 0: 1
1: 0
2: 0
3: 31
4: 267
Right 1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 3
3: 56
4: 403
1028762322_1028762337 12 Left 1028762322 7:94509879-94509901 CCGAGTCGGCCGCGGCCGAGGAG 0: 1
1: 0
2: 1
3: 11
4: 91
Right 1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 3
3: 56
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028762337 Original CRISPR GTCGGGGGCGCCGCGGCCGC GGG Exonic
900135704 1:1116102-1116124 GGCGGTGGCGCCGCGCCCCCTGG + Intronic
900349733 1:2228666-2228688 GTCGGGGCCGCGGGCGCCGCCGG + Intergenic
900364803 1:2306774-2306796 GTCGGCGGCGCTGCGGCGGCAGG - Exonic
901005470 1:6169768-6169790 GGCTGGGGCGCTGGGGCCGCAGG - Intronic
901057629 1:6456024-6456046 GTCGGGGGAGGCGCGGCGGGCGG - Intronic
901066605 1:6497360-6497382 GGCGGGGGCGCCGGGGACGCCGG + Intronic
901109773 1:6785440-6785462 GGCGGGTGCGCGGCGGCGGCGGG + Exonic
901272289 1:7961753-7961775 GGCCGGGGCGCCGCGTCCGCAGG + Intronic
902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG + Intronic
902786816 1:18738319-18738341 GCCGGGGCTGCCGCTGCCGCTGG - Intronic
902916701 1:19644143-19644165 GGAGGGGGCGCCGCGGCGGCAGG - Intronic
903210342 1:21814669-21814691 GCCGGGGGCGCCCCGGCCCCTGG + Exonic
903413930 1:23168660-23168682 GTCGGGGCACCCGCGGCCACGGG - Intronic
903897769 1:26620359-26620381 GTCGGGGGCGCAGCTGCCGCCGG - Intergenic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
904941006 1:34164865-34164887 GTGGGGCGCGCGGCGGCCGCTGG + Intronic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
906615831 1:47232238-47232260 GGCGGGGGAGCGGGGGCCGCGGG - Intergenic
906627026 1:47333829-47333851 GGCGGGGCCGCGGCGGGCGCCGG + Exonic
906650359 1:47508451-47508473 CCTGGGGCCGCCGCGGCCGCAGG + Intergenic
907069200 1:51518990-51519012 GGCGAGGTCGCGGCGGCCGCAGG + Intronic
907515681 1:54991885-54991907 GTTGGGGGCCCCTCGGCCACTGG - Exonic
908355609 1:63323069-63323091 GTCGCTGGCGCTGCCGCCGCCGG - Exonic
908555697 1:65254689-65254711 GGCAGGGGCGCAGCGGCGGCGGG + Intronic
910569612 1:88684711-88684733 GCTAGGGGCGCGGCGGCCGCAGG - Intronic
910981303 1:92961762-92961784 GGAGGGGGCGCCGCGGCAGCGGG + Intergenic
914386263 1:147172605-147172627 GTCCCGGGCGCCGAGGCTGCAGG - Intergenic
915354997 1:155250597-155250619 GTGGGGGGCGCCGTGGCAGGGGG + Exonic
915463186 1:156081730-156081752 GCCGGGGGCGCCGCGGGCGGCGG + Exonic
916233350 1:162561663-162561685 ATCCGGGGGGCCGCGGCGGCGGG - Exonic
920352115 1:205344097-205344119 GGCGGGGGCGCCGAGACTGCGGG - Intronic
920385627 1:205568890-205568912 GGCGGGGGCGCCTCTGCGGCGGG - Intronic
921010305 1:211134208-211134230 GTAGGGGGCGCCGCCGGCCCAGG - Intergenic
921384021 1:214551702-214551724 GGTGGGGGAGCCGTGGCCGCCGG - Intronic
922768018 1:228166063-228166085 GGCGGGGCCCCCGCGGCCGCAGG - Exonic
922851300 1:228735807-228735829 GTCGGGAGCGCGGTGGACGCGGG + Exonic
1064354285 10:14603991-14604013 GCGGGGGGCGCCGCGGAGGCGGG - Intronic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1066464236 10:35639514-35639536 GGCGCGGGCGCCACGGCCGCGGG - Exonic
1066464400 10:35640333-35640355 GGCGCGGGCGCGGCGGGCGCGGG - Exonic
1066464407 10:35640354-35640376 GGCGCGGGCGGCGCGGCGGCGGG - Exonic
1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG + Exonic
1070327862 10:75399869-75399891 ACCGGGGGCGCCTCGGCCGAAGG - Exonic
1071309460 10:84328839-84328861 GCCGGGGTCGCGGCGGGCGCCGG + Intronic
1071530900 10:86389803-86389825 GCCAGGGTCGCCGCTGCCGCCGG + Intergenic
1071997721 10:91163503-91163525 GGCGGAGGCGCCGCTGCTGCCGG - Intronic
1072207908 10:93221053-93221075 ATCAGGGGCGCAGAGGCCGCGGG + Intergenic
1072710766 10:97714404-97714426 ATCGGGGCCGCGGCGGGCGCGGG - Exonic
1072926467 10:99620886-99620908 GTCGGGGGCGGGGCGGCGACAGG + Intergenic
1073137723 10:101229018-101229040 GACGCGGGCGCCGCTGCTGCTGG + Exonic
1073290058 10:102409101-102409123 GGCCGGCGCGCCGCGGCCCCCGG + Intronic
1074586009 10:114768241-114768263 GGCGGGGACGCAGCGGCCGCAGG + Intergenic
1074618489 10:115093483-115093505 GTCCGGGACGCCGCGGCTGTGGG + Intronic
1075629345 10:123991787-123991809 GTCGCGGGCACCGTCGCCGCGGG - Intergenic
1076864356 10:133159939-133159961 GTGGGGGGCGGGGCGGTCGCTGG - Intergenic
1076999600 11:315997-316019 GTCGGGGGTGCGCGGGCCGCGGG + Intergenic
1077194444 11:1272285-1272307 GGCCGGGGCGCCGCGGGTGCCGG - Intergenic
1077231672 11:1460613-1460635 CTCGGTGACTCCGCGGCCGCTGG + Exonic
1077250113 11:1557151-1557173 GTCGGGGGGCCCGGGGCCGTCGG + Exonic
1077322132 11:1947249-1947271 GGGGGGGGCGGCGCGGCCTCCGG + Intergenic
1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG + Exonic
1077898832 11:6474024-6474046 GGCGGGGCCTCCGCGGCGGCGGG - Intronic
1077923101 11:6655876-6655898 GGCGGGGGCTCCGCGGGCGGAGG - Intergenic
1078679633 11:13463371-13463393 GTTGAGGGCGCGGCGGCCACGGG + Intergenic
1079362008 11:19777295-19777317 GGCGGGGGCGAGGCGACCGCGGG + Intronic
1079450781 11:20598298-20598320 GCCGCGGCGGCCGCGGCCGCAGG - Intergenic
1081851499 11:46277952-46277974 GACGGAGGCGGCGCGGCCCCGGG - Exonic
1083595549 11:63916967-63916989 GTCGCCGCCGCCGCCGCCGCCGG - Intergenic
1083883038 11:65557887-65557909 GGCGGGGGCGGCGGGGCTGCTGG - Exonic
1084070081 11:66728186-66728208 GGCGGGGGCGCGGCGGGCGGGGG + Intronic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084257935 11:67955428-67955450 GCCGGGGGTGCCGGGGACGCGGG - Intergenic
1084263241 11:67991886-67991908 GTGCGGGGCGAGGCGGCCGCGGG - Intronic
1084265665 11:68003992-68004014 GGCGGGGGCTGCGGGGCCGCAGG - Exonic
1084295830 11:68213111-68213133 GTCGGGGGAGGGGCGGGCGCCGG - Intronic
1085011112 11:73142266-73142288 GTGGGGGCCGCTGCGTCCGCCGG - Intergenic
1085208148 11:74749316-74749338 GACGGGGGCGCGGCTGCCGCGGG + Exonic
1085666316 11:78417980-78418002 CTCGGGGGCGCGGCGGGAGCGGG - Intronic
1090190412 11:124762823-124762845 GGCGGGGGCTGCGCGGCCACCGG + Intergenic
1202805150 11_KI270721v1_random:2562-2584 GGGGGGGGCGGCGCGGCCTCCGG + Intergenic
1091404316 12:199481-199503 GTTGGGGGAGCAGCGGCGGCCGG + Intronic
1091450561 12:569953-569975 GACTTGGGCGCCGCGGCTGCCGG + Intronic
1092143802 12:6201092-6201114 GGCAGGGGTGCCTCGGCCGCGGG + Intronic
1092743020 12:11648947-11648969 CTCGGGGATGCGGCGGCCGCGGG - Intergenic
1093077033 12:14769612-14769634 GTAGGGGTCGCCCCGGCCTCCGG - Intronic
1094460847 12:30695655-30695677 GGTGGGGGCTCCGCGGCCCCCGG + Exonic
1095431955 12:42144385-42144407 GTGGGGGACGCGGCGGGCGCGGG - Intronic
1095752373 12:45727547-45727569 GGCGGCGGCGGCGCGGCGGCAGG + Intergenic
1096077638 12:48815135-48815157 GTCGGGGTCGCAGCCGCCGCCGG + Intronic
1096240159 12:49955615-49955637 GTCGGGGCCGTAGAGGCCGCTGG - Exonic
1096498362 12:52051368-52051390 GGCGGGGGCGCCACTGACGCAGG - Intronic
1100572749 12:95858556-95858578 TTTGGGGGCGCCTCTGCCGCAGG - Intergenic
1101102434 12:101407588-101407610 CTCGAGGGAGCCGCGGCCGAGGG - Intronic
1102101281 12:110281024-110281046 GCCGCGCGCGCCGCGGTCGCGGG - Intronic
1102136861 12:110582933-110582955 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1102370857 12:112381791-112381813 GCAGGTGGGGCCGCGGCCGCAGG - Intronic
1102853861 12:116277232-116277254 GGCCGGGCCGCCGCCGCCGCCGG + Exonic
1104448815 12:128853484-128853506 GGCGGGGGAGCCGGGGCGGCTGG - Intronic
1104860672 12:131921760-131921782 CTGGGGGACGCCGAGGCCGCAGG - Exonic
1104989595 12:132618428-132618450 GTGGGGGGCGCCGCGGAGGCCGG + Intergenic
1105525700 13:21176321-21176343 GTGGGGTGCGCCGCGGGCGGAGG - Intronic
1105964482 13:25372181-25372203 GTCGGGGGCTCGGCGGCCCCGGG - Exonic
1106109039 13:26760816-26760838 GGCGGGGGCGGCGCGCGCGCGGG - Intergenic
1107548964 13:41457735-41457757 CCCGCGGCCGCCGCGGCCGCAGG + Exonic
1108292556 13:48976057-48976079 CTCAGGGCCGCCGCGGCCGCCGG - Intronic
1110630110 13:77697884-77697906 CCCGAGGGCGCCGCGGCCGCCGG - Intronic
1110705970 13:78602240-78602262 GTCGTGGGCGCCGCCGCCGCCGG + Exonic
1110705973 13:78602256-78602278 GGCGCGGGCGCGGCGGCCGGCGG - Exonic
1112402250 13:99086858-99086880 GTCGGGGCCGCCTCCGCCCCGGG + Intergenic
1112506989 13:99981399-99981421 GGCGGGGGCGCCGGGGCGGCAGG - Intergenic
1113656012 13:112068136-112068158 GGCGTGGGCGCGGCGGCCGTGGG + Exonic
1114865999 14:26597152-26597174 GGCAGGGGCGCAGGGGCCGCCGG + Intronic
1115502228 14:34060199-34060221 TTCGGGGCGGCCGCGGGCGCAGG - Intronic
1115651212 14:35404126-35404148 GCCGGGGGCGGGGCGGCAGCGGG - Intronic
1116849519 14:49893711-49893733 GTCGGAGGAGCCGGGGCCGGGGG - Exonic
1117302233 14:54441156-54441178 GTCCGGGCCGCCACGGCCGCCGG - Intronic
1117913871 14:60657346-60657368 GCCGGCGGCGGCGCGGCCGGAGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121617009 14:95319974-95319996 GTCGGGGCCGCCCCCGCCGCGGG + Intergenic
1122226837 14:100285392-100285414 GCAGGGTGCGCCGCCGCCGCCGG + Intergenic
1122445032 14:101761823-101761845 GGCGGGGGCGCTGCTGCTGCGGG + Exonic
1122523459 14:102363144-102363166 GTCGGGGGCGTCGGGGGCGTCGG - Intronic
1122620958 14:103057460-103057482 GGCGGGGAGGGCGCGGCCGCGGG - Exonic
1122776077 14:104117493-104117515 GTCGCTGTCGCCGCGCCCGCCGG - Intergenic
1122779156 14:104136365-104136387 GTGCGGGGCGCGGCGGCGGCGGG + Intergenic
1122886715 14:104713535-104713557 GTCGGTGTCCCCGCGGCCCCGGG - Exonic
1122952285 14:105051666-105051688 GTCGGGGCCGCCGCCGCCGGAGG - Exonic
1122978565 14:105181093-105181115 GGCGGGGGCGCGGGGGACGCGGG + Intronic
1123630704 15:22258109-22258131 GTAGGGGGACCCGCGGCGGCCGG - Intergenic
1125508790 15:40282038-40282060 GGCGGCGGCGGCGCGGCCCCAGG + Exonic
1127117582 15:55743186-55743208 GTGGACAGCGCCGCGGCCGCGGG + Intergenic
1128119182 15:65133394-65133416 GCCTGAGGCGCCGCCGCCGCCGG - Exonic
1128309656 15:66622255-66622277 CTCGGAGACGCCGCGGCCGCGGG - Intronic
1130517185 15:84634216-84634238 GGCGGGGACGCGGCCGCCGCGGG - Intergenic
1131144346 15:90001681-90001703 GGCGGGGGCGCGGGGGGCGCGGG + Intronic
1131517711 15:93089845-93089867 CGCGGGGGAGCCGCGGCCGTGGG - Intergenic
1131827172 15:96331169-96331191 GCCCGGGCCGCCGCTGCCGCCGG - Exonic
1131830876 15:96353986-96354008 GTCTGGGGCGCCGCGCCCTCCGG + Intergenic
1131832212 15:96361210-96361232 GCCGGGGGCGGGGAGGCCGCGGG - Intergenic
1132560088 16:589641-589663 GCCGGGGGCGGGGCGGCCGGCGG + Intronic
1132695964 16:1202132-1202154 GTCGGGGGGTCCGCGGCCTGGGG - Exonic
1132831242 16:1929529-1929551 GGCGGGGGTGGCGCGGCCGGTGG - Intergenic
1133802029 16:9092010-9092032 GGCGGTGGCGGCGAGGCCGCGGG + Exonic
1134134146 16:11668576-11668598 GGCGGGGGCGCCGGGGCCCGGGG + Intronic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1134419390 16:14071543-14071565 GGCGGGGCGGCCGGGGCCGCGGG + Intronic
1135712469 16:24729605-24729627 TCCGGGGGCGCCACGGCCACTGG - Intergenic
1136385921 16:29925990-29926012 GACGGGGCCGCGGCGGCAGCCGG + Exonic
1136454030 16:30370303-30370325 GCCGGGGGCGGAGCGGCCGCTGG + Intergenic
1138507711 16:57486430-57486452 GGCGAGGGAGGCGCGGCCGCAGG + Exonic
1139534372 16:67562506-67562528 GTCGGCGCTGCCGGGGCCGCGGG - Exonic
1140927571 16:79599175-79599197 GGCGGGGGCGCGGCGGGGGCGGG - Exonic
1141054530 16:80803721-80803743 GGGGGGCGCGCCGCGGCCGGCGG - Intronic
1141531366 16:84648802-84648824 AGTGGGGGCGCCGCGGCCGGGGG + Intronic
1141582727 16:85011329-85011351 GTCGCCGCCGCCGCCGCCGCAGG - Exonic
1141828540 16:86497196-86497218 GCCGATCGCGCCGCGGCCGCCGG - Intergenic
1142075766 16:88116821-88116843 GTCGGGGGAGTAGGGGCCGCAGG + Intronic
1142156491 16:88534776-88534798 GGCGGGGGCGGCACGGCCTCGGG - Exonic
1142350096 16:89575822-89575844 GTCGGCGCCGCCGCGGCGCCCGG - Exonic
1142474534 17:181258-181280 GTCGGAGGGGCTGCGGCGGCCGG + Exonic
1142518883 17:491455-491477 CTCGGGGGCTCCGCAGGCGCGGG + Intergenic
1143150836 17:4807077-4807099 CTCGGGGGCGGGGCGGCCCCCGG - Exonic
1143492923 17:7294439-7294461 GTCGCGGGCACCGTCGCCGCGGG + Exonic
1143539792 17:7562169-7562191 GGCGGGGCCGCCGCCGTCGCCGG + Exonic
1144724849 17:17496625-17496647 GCCGCGGGCTCGGCGGCCGCAGG + Intergenic
1144764350 17:17724710-17724732 GTCAGGGGCGCCGAGTCCCCAGG - Intronic
1145787859 17:27605627-27605649 GCCGGGTGCACCGCGGCCGCTGG + Exonic
1146079093 17:29761206-29761228 GTCGGGGCCACCGAGGCTGCAGG + Intronic
1146271540 17:31488545-31488567 GGCAGGGGCGCTGCGGCCGGAGG - Intronic
1147158613 17:38558315-38558337 GTCGGAGGCGGCGCGGCGGCAGG - Exonic
1147653022 17:42072710-42072732 GGCGGGGGCGGCGCGGCTCCTGG - Intergenic
1148768987 17:50056198-50056220 GACGGCGGCGACCCGGCCGCTGG + Intronic
1148945593 17:51259888-51259910 GGAGGGGGCGCCGCGGGCTCGGG - Exonic
1152049108 17:77958838-77958860 GGCGGGAGCGCGGCGGGCGCTGG - Intergenic
1152538797 17:80964582-80964604 GACAGAGGCGCCGTGGCCGCGGG - Exonic
1152571241 17:81122154-81122176 GTAGTGGTCGCCGCGGCCCCAGG + Exonic
1152822851 17:82446000-82446022 AACGGGGGCCCCGTGGCCGCTGG + Intronic
1152823710 17:82450503-82450525 ATCGGGGGCGCTCCCGCCGCCGG + Exonic
1152834407 17:82519946-82519968 GCCGGGGGCGGCGGGGCCGGGGG + Exonic
1154303867 18:13217401-13217423 CGCGCGGGCGCCGAGGCCGCGGG - Intergenic
1155221541 18:23689936-23689958 GTCGGGGGCCCCACCGCCCCAGG + Exonic
1157464293 18:47930773-47930795 GTGCGTGGCGCCGCGGCGGCCGG - Intronic
1158579901 18:58671831-58671853 GTCGCGGGCGCCTCCGCCTCAGG + Exonic
1158893577 18:61894260-61894282 GCCGGAGGAGCGGCGGCCGCCGG - Intergenic
1160454696 18:78992436-78992458 GTTGGGGGTGCAGGGGCCGCAGG - Exonic
1160842820 19:1154151-1154173 GTCGGGTGGGCCGGGGCCGGGGG + Intronic
1160873118 19:1285942-1285964 GCCGGGGTCGCCCCGGGCGCAGG - Intergenic
1160875774 19:1295629-1295651 CTATGGGGCGCCGCTGCCGCCGG + Exonic
1160909223 19:1467214-1467236 GGCGGGGGCGCCGGGGGCGCCGG + Exonic
1160930438 19:1567577-1567599 GTCGGGGGCCCCAGGGCCGCGGG + Exonic
1160930492 19:1567718-1567740 GTCGGGGGCGCGCCGGCCTCAGG + Exonic
1160947871 19:1652009-1652031 GGCGGGGGCGCGGGGGGCGCCGG - Intronic
1160967706 19:1753846-1753868 GGTGGGGGCGCCGGGGGCGCGGG + Exonic
1160967774 19:1754101-1754123 GGCGGGGGCGGCGCGGCCGCCGG - Exonic
1161203699 19:3029372-3029394 GCCGGGGGGGGCGCGGGCGCGGG - Intronic
1161309396 19:3585661-3585683 GCCGGGGGCTCCGAGGGCGCGGG - Exonic
1161397938 19:4054541-4054563 GTCGGGGGCCGCTCGGCCGGGGG + Exonic
1161584254 19:5096598-5096620 GCCGGGGGCACCGCGGCAACAGG - Intronic
1162033244 19:7926170-7926192 GACGGGGGCGGGGCCGCCGCGGG + Intergenic
1163426890 19:17245185-17245207 GCCGGGGCCGCCCCAGCCGCCGG + Exonic
1163607052 19:18281273-18281295 GTAGGAGGCGGCGCGGCCGCAGG + Exonic
1163708612 19:18832352-18832374 GCCCGGGCCGCCGGGGCCGCCGG - Exonic
1163845757 19:19637407-19637429 GGCGGGGGCGGCGGGGCCTCGGG + Exonic
1165065726 19:33226818-33226840 GTCGGGGCCACCGGGGCGGCGGG + Intergenic
1165080065 19:33301940-33301962 GGCGCCGGCGCTGCGGCCGCTGG - Exonic
1165349798 19:35269321-35269343 GCCGGGGGCGCCGCCGAGGCCGG - Intronic
1165879419 19:39031991-39032013 GCCGGTGGCGCCGTGGTCGCGGG + Exonic
1165914368 19:39248545-39248567 GTCTGGGCCGCAGTGGCCGCGGG - Intergenic
1166797966 19:45439626-45439648 GGCAGGGGCGCCGCGCCCCCTGG - Intronic
1166883019 19:45940398-45940420 GTCCTGGCCGCCGTGGCCGCCGG - Exonic
1167110415 19:47457392-47457414 TTCGTGGGCGCCGAGGCCCCAGG - Exonic
1167268277 19:48493963-48493985 GGCGGGAGCGCCGGGGCCGGCGG - Exonic
1167309539 19:48729073-48729095 ATCGTGCGCGCCGCAGCCGCCGG - Exonic
1167797545 19:51719640-51719662 GGCGGCGGCGCGGGGGCCGCTGG - Exonic
1168076343 19:53982589-53982611 GCCGGGGGCGCCGGGGGCGGCGG + Exonic
1168104016 19:54155747-54155769 GGCGGGGGCGCCGGGCCAGCTGG + Exonic
1168307264 19:55442412-55442434 GCTGGGGGCGCCGGGGGCGCTGG - Exonic
1168311794 19:55464434-55464456 GCCGGGTGCGCCGGGGCTGCAGG + Intergenic
1168343809 19:55641052-55641074 GCCGGCGGCGCCGGGGACGCGGG - Intronic
1168536056 19:57171983-57172005 GTCCGGGGGGCGGGGGCCGCGGG + Intergenic
925169689 2:1743514-1743536 AGCGGGGGCGCCGCGGCTGCGGG + Intronic
925609927 2:5693862-5693884 CTGGGGGGCGGCGCGGCGGCCGG + Exonic
927115881 2:19901668-19901690 CCCGGGGTCGCCGCGGCCCCAGG + Intronic
927714284 2:25342107-25342129 GCCGGGGCCAGCGCGGCCGCGGG - Intronic
927938155 2:27086745-27086767 GGCGGGGCCGCCGCGACCGCGGG + Exonic
928904815 2:36356942-36356964 GGTGGGGGCGCCGCGGGCGGGGG + Intronic
929501380 2:42493941-42493963 GACGGCGGCGGGGCGGCCGCCGG - Exonic
930096572 2:47570671-47570693 GCCCGGGGCCCCGCGGACGCCGG - Exonic
931253780 2:60553850-60553872 GGAGGGGGCGCTGGGGCCGCGGG + Intergenic
931719437 2:65056559-65056581 GTCGGGGGTGCCGCGGCGCTGGG + Intronic
931763600 2:65436192-65436214 AGCGGGGGCGCCGCGGCAGCGGG - Intergenic
932314121 2:70768304-70768326 GTGGGGGGCGCTGCGGGCGGGGG - Intergenic
932567358 2:72918153-72918175 GCCGCGGCCGCCGCGGGCGCGGG + Exonic
933776152 2:85772398-85772420 GGAGGGGGGGCCGCGGCGGCCGG - Intronic
934566974 2:95346591-95346613 GGCGGCGGCGGCGCGGCGGCGGG - Intronic
935149135 2:100417727-100417749 GTGGGGAGGGGCGCGGCCGCGGG + Intergenic
937917651 2:127106803-127106825 GGCCGGGGCTCCGCGGCGGCTGG + Intronic
937950995 2:127387898-127387920 GACGAGGGTGCCGCGGCCGCTGG - Intronic
938073041 2:128318408-128318430 GTCGGGCGGCGCGCGGCCGCCGG + Exonic
938343426 2:130549892-130549914 GTCGGGGACGCCCAGGCCACCGG - Intergenic
938346407 2:130570830-130570852 GTCGGGGACGCCCAGGCCACCGG + Intronic
938397856 2:130963973-130963995 GGCGGCGGTGCGGCGGCCGCGGG - Intronic
939900614 2:147845242-147845264 GCAGCGGCCGCCGCGGCCGCAGG - Intronic
940300894 2:152175711-152175733 GTCTAGGGAGCCGCGGCCGCGGG - Exonic
942240783 2:173963655-173963677 GTCGGGGGAAGCGCGGGCGCCGG + Intronic
942240824 2:173963765-173963787 GCCGGGGCCCCCGCCGCCGCCGG - Exonic
942261699 2:174171880-174171902 GGCGGGGGCGCGGCGTCTGCTGG - Intronic
942303582 2:174585533-174585555 GTCGGGGGCGGCGGGGGTGCTGG + Exonic
942446139 2:176080240-176080262 GGCGGGGGCGCCGGGGCCGGGGG - Exonic
943470890 2:188292451-188292473 GTCGGGGACGCAGCGGTCTCCGG + Intronic
945251047 2:207767079-207767101 AGCGGGGGCGCCATGGCCGCAGG - Exonic
946247473 2:218396025-218396047 GGCGTGGGAGTCGCGGCCGCCGG - Exonic
948116012 2:235494589-235494611 GCCCGGGGCGCCGCAGCCCCCGG - Exonic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
948612279 2:239177491-239177513 GTTGGGGGTGCCGAGGCCGGAGG + Intronic
948991847 2:241559448-241559470 GTGGGGGGCGCCGCACCTGCGGG - Exonic
1168804321 20:663591-663613 GGCGAGGGCGCTGCGGGCGCAGG + Exonic
1168804447 20:664206-664228 GGCGGGGGCGGCGGGGACGCGGG - Exonic
1170150536 20:13221867-13221889 GACGGGCCCGACGCGGCCGCGGG + Exonic
1170890146 20:20369038-20369060 GGGGGGCGCGGCGCGGCCGCTGG + Exonic
1171123708 20:22584899-22584921 GTGCGGGGCGCCGCGGCGGTGGG - Intronic
1171493365 20:25537773-25537795 GTGGGGGGCGCAGCTGCCTCAGG + Intronic
1172061552 20:32190223-32190245 GGCGGGCGCGCCGCGGCTTCTGG + Intergenic
1172118532 20:32584912-32584934 CTCGGGGGCGGGCCGGCCGCCGG + Intronic
1172284639 20:33732129-33732151 CTAGGGCGCGCAGCGGCCGCGGG + Intronic
1172618683 20:36306347-36306369 ATCTGGGGCGCCGCGCCGGCCGG + Exonic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1174287684 20:49483985-49484007 GGCGGGGGCGCCCGGGCGGCCGG - Intergenic
1175847101 20:62064993-62065015 GGCGGGGGCGGGGCGGCGGCGGG + Exonic
1175847123 20:62065041-62065063 GGCGAGGGCGCGGCGGGCGCGGG + Exonic
1175902895 20:62366971-62366993 GTAGGGGGCCCCGTGGCCGGCGG - Exonic
1176125392 20:63472658-63472680 GGCGGAGCCGGCGCGGCCGCGGG - Intergenic
1176194520 20:63831121-63831143 AGGGCGGGCGCCGCGGCCGCCGG + Intronic
1176286803 21:5022833-5022855 GGCGGAGGCGCCGGGGCGGCCGG + Intronic
1176302148 21:5103614-5103636 GTCGGGGCCTCCGAGGCCTCTGG + Intergenic
1176379653 21:6105712-6105734 ATCGGGGGCGCGGCGGCATCGGG - Intergenic
1176556250 21:8255723-8255745 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176575189 21:8438765-8438787 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176705828 21:10119594-10119616 GGCGGCGACGCCGCGGCTGCGGG + Intergenic
1178334670 21:31732280-31732302 GCCGCGGCCGCCGCCGCCGCCGG - Intergenic
1178922594 21:36748131-36748153 CTCGGTGGCGCCGCAGCCCCGGG - Exonic
1179213753 21:39349151-39349173 GTGGGGGGCGGCCCGGCCGGCGG - Exonic
1179511825 21:41878821-41878843 GGCGGGGGCCGCGGGGCCGCGGG + Exonic
1179743821 21:43432525-43432547 ATCGGGGGCGCGGCGGCATCGGG + Intergenic
1179810170 21:43865152-43865174 GGCGGCGGCGGCGCGGCCGAGGG + Intergenic
1179870378 21:44240642-44240664 GGCGGAGGCGCCGGGGCGGCCGG - Intronic
1179989516 21:44939946-44939968 GCCGGGAGCCCCGCGGCCGCCGG - Intergenic
1180167872 21:46039337-46039359 GTCGGGGGCGCCTGGGTTGCCGG - Intergenic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1181155403 22:20917201-20917223 GCTGGGGGCGCTGCGGCTGCCGG - Intergenic
1181638645 22:24185729-24185751 GTCGGGAGTGCTGCCGCCGCTGG - Exonic
1182094079 22:27614525-27614547 GTCACGGGCGCCGCGCCCGCGGG + Intergenic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1183702321 22:39457495-39457517 GGCGGCGGCTCCGCGGCCCCCGG - Exonic
1184101448 22:42343607-42343629 GGCGAGGACGCGGCGGCCGCGGG - Intronic
1184152985 22:42649264-42649286 GGAGGGGGCGCCGGGGCCGCGGG - Intronic
1184766998 22:46577239-46577261 GAGGGGGGCGCCGCGGCGGGTGG + Intronic
1185051336 22:48555800-48555822 GATGGGGGCGCTGTGGCCGCTGG + Intronic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
1203253238 22_KI270733v1_random:127820-127842 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203261293 22_KI270733v1_random:172901-172923 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
950509829 3:13419694-13419716 GGAGGGGGCGCCGGGGCAGCTGG - Intronic
953909284 3:46883514-46883536 CTCGGGGCAGCCGCCGCCGCCGG - Exonic
953947574 3:47163352-47163374 GTCCGAGGCGCCGCCGTCGCGGG + Intronic
954194704 3:48989784-48989806 TTTGGGGGCGCCGCGGAGGCTGG - Intergenic
954686586 3:52373334-52373356 GGCGGGGGCGCTGCTGCTGCGGG + Intronic
956658948 3:71581522-71581544 GTCGAGGCGGCCGCGGGCGCGGG - Intronic
956675047 3:71725336-71725358 GCGGGGGGCGCGGCGGCCGGGGG + Exonic
957078680 3:75619828-75619850 GTGTGGGGCGAGGCGGCCGCGGG - Intergenic
962808880 3:138945722-138945744 GCCGGGGGCGCGGCGGTGGCTGG + Exonic
962808998 3:138946169-138946191 GTGGCGGGCGCCGGGGCCGACGG - Exonic
963081933 3:141402507-141402529 GCCACGGGCGCCGCGCCCGCAGG - Intronic
966182237 3:177197669-177197691 GGGAGGGGCGCCGCGGACGCCGG + Intergenic
966411851 3:179653146-179653168 CTCGCTGGCGCCGCCGCCGCCGG + Exonic
966592241 3:181695879-181695901 GTCGGCCCCGCCGCGGCCCCAGG + Intergenic
966849384 3:184155379-184155401 GCCGGGAGGGCCGCGGCCACCGG + Exonic
967859046 3:194137961-194137983 GGAGGGGGCGCCGCGCCCCCGGG - Exonic
968213334 3:196867782-196867804 GGCGGGGGCGGGGCGGCCCCGGG + Intergenic
968230781 3:197003433-197003455 GCCCCGGGCGCCGGGGCCGCTGG + Exonic
968433829 4:575211-575233 CTCGGGCGCGCCGGGGCCGGCGG - Intergenic
968512957 4:1003348-1003370 GGGCGGGGCGCCGCGGCCACCGG - Exonic
968529446 4:1083014-1083036 GTCGGGGGCGCAGCGGTCTGGGG + Intronic
968556772 4:1249593-1249615 GCCAGGGGCACCGAGGCCGCGGG + Intronic
968629082 4:1641074-1641096 GTCGGGGCCACGGCTGCCGCCGG - Exonic
968629099 4:1641136-1641158 GTCGGGGCCACGGCTGCCGCCGG - Exonic
969021761 4:4143796-4143818 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
969791702 4:9497704-9497726 GTGCGGGGCGAGGCGGCCGCGGG + Intergenic
972418848 4:38868012-38868034 GTCTGGGGCGGCGCGGCCGAGGG + Intronic
976897370 4:90128111-90128133 GGAGCGGCCGCCGCGGCCGCAGG - Intronic
977257683 4:94758379-94758401 GTCGGGGCAGCGGCGGCGGCGGG + Intronic
977810035 4:101347393-101347415 GCCGCTGGTGCCGCGGCCGCCGG + Exonic
980969408 4:139555614-139555636 GACGGGGCCGCGGCCGCCGCGGG + Intronic
980990474 4:139735004-139735026 GGCGCGGGCGCAGCGGCGGCCGG - Intronic
982460935 4:155667730-155667752 GCGGGGCGCGCCGGGGCCGCTGG + Intronic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
983398495 4:167233915-167233937 GAGGCGGGGGCCGCGGCCGCCGG - Intronic
984765720 4:183398924-183398946 CCCGGGTCCGCCGCGGCCGCGGG + Intergenic
984928256 4:184825651-184825673 GTCGCGGGCGGCGCGGGCGCGGG - Intronic
984952614 4:185018480-185018502 CGCAGGGGCGCAGCGGCCGCGGG - Intergenic
985542914 5:495094-495116 TGGGGGGGCGCCGTGGCCGCAGG + Intronic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
991054450 5:62306352-62306374 GCCCGGGCCGGCGCGGCCGCGGG + Intronic
992663608 5:78984901-78984923 GGCGGGGGCGGCGCGGGCGGCGG + Intronic
992940074 5:81751950-81751972 GCAGGGGCCGCTGCGGCCGCAGG - Intergenic
996329321 5:122311957-122311979 GCCGGGGCCGCCGCGCCCTCAGG - Intronic
997470582 5:134114925-134114947 GGCGGGGGCGGCGCGGGCGGCGG + Exonic
998463425 5:142325430-142325452 GTGGGGGACGCTGCGGCCTCCGG + Intronic
999188573 5:149730624-149730646 GCTGGGGGCGCTACGGCCGCTGG + Intronic
999300013 5:150485530-150485552 CTCGGAGCCGCCGCGGGCGCGGG + Intergenic
999726984 5:154445896-154445918 GGCGGGGCTGCCGCCGCCGCTGG - Intergenic
1000014693 5:157266451-157266473 GGCGGGGGAGCCGCAGCAGCAGG + Intronic
1000302954 5:159972314-159972336 GTCGTGGCGGCCGCGGCGGCCGG - Exonic
1001561257 5:172670335-172670357 GTCGCGGGCGCGGCGCCCCCTGG + Intronic
1001586005 5:172834311-172834333 GGCGGGGGCGGGGCGGCCGGAGG + Exonic
1002021213 5:176365560-176365582 CCCGATGGCGCCGCGGCCGCTGG + Exonic
1002055832 5:176597478-176597500 GGCGGGGGCGCTGCGGCCTCTGG + Exonic
1002091671 5:176810151-176810173 GCCGGGGTCGCCGCAGCCCCGGG + Intergenic
1002133599 5:177095585-177095607 CTGGGGGGCGCCGGGCCCGCAGG - Exonic
1002140404 5:177134087-177134109 GCCGGCGGCGCTGCAGCCGCCGG + Intronic
1002176434 5:177403809-177403831 GACGGAGGAGCCGCGGCCCCTGG + Intronic
1002580848 5:180208858-180208880 GGCGGGGTCCGCGCGGCCGCCGG - Intronic
1002632304 5:180590308-180590330 GGCGGGGGCGCGGCAGCGGCCGG + Intronic
1002897998 6:1390176-1390198 GGCGGCGGCGGCGCGGGCGCCGG + Exonic
1002927249 6:1611577-1611599 GGCGGCGGCGCGGGGGCCGCGGG + Exonic
1004044673 6:12012375-12012397 GACCGGGGAGCGGCGGCCGCCGG + Exonic
1004193871 6:13487270-13487292 GGCTGCGGCGGCGCGGCCGCGGG - Exonic
1004650248 6:17600884-17600906 GGCGGCGGCGCCGCGGCCTGGGG - Exonic
1004690437 6:17987996-17988018 GGGGGGGGCCCCGCGGGCGCCGG - Intergenic
1007737696 6:43991805-43991827 GTCGGGGGCGGCGGGGGCGGGGG + Intergenic
1009905608 6:69867241-69867263 CTGGGGGGCGGCGCGGGCGCGGG + Intronic
1011517273 6:88167069-88167091 CTCGGGCGCGCCCCGCCCGCCGG + Intergenic
1013099659 6:106975471-106975493 TTCGGGGAGGGCGCGGCCGCGGG - Intronic
1013230562 6:108158010-108158032 CGGGGGGGCGGCGCGGCCGCGGG - Intronic
1013793303 6:113858995-113859017 CTCGGGGGCGCCTCGGCCTGCGG + Intronic
1016010776 6:139135574-139135596 GCCGGAGGCGCGGCGGGCGCCGG + Exonic
1016010793 6:139135631-139135653 GCCGCGGGGGCTGCGGCCGCGGG + Exonic
1016933244 6:149429271-149429293 GTGGGGGGCTCAGCGGCTGCAGG - Intergenic
1017325134 6:153133923-153133945 GTCGGGGAGGCTCCGGCCGCAGG - Intergenic
1017671971 6:156777710-156777732 GGCGGCGGCGGCGCGGGCGCGGG + Intergenic
1018968439 6:168507583-168507605 GTGGGGGGCGCCCCGGGGGCAGG - Intronic
1019230235 6:170554391-170554413 GTGGCGGGCGCCTGGGCCGCCGG + Exonic
1019446345 7:1073667-1073689 GTGGGGGGCGTCACGGCGGCGGG - Intronic
1019446358 7:1073700-1073722 GTCGGGGGCGTCACTGCAGCAGG - Intronic
1019446501 7:1074134-1074156 GTCGGGGGCGTGACGGCAGCGGG - Intronic
1020281785 7:6653553-6653575 TTCGGCGGCGGCGGGGCCGCGGG + Exonic
1020309179 7:6855826-6855848 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
1021958798 7:25852580-25852602 GGCGGGGGCGCGGAGGACGCGGG - Intergenic
1021969379 7:25951419-25951441 GGCGGGGGCGCGGCCGGCGCTGG + Intergenic
1022698007 7:32728685-32728707 GGCCGGGGGGCCGCCGCCGCGGG + Intergenic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1023831459 7:44040928-44040950 GTGCGGGGCGCAGCGGCAGCGGG - Intergenic
1023842271 7:44104313-44104335 GGCGGGGGCGCCGGGGCTTCCGG - Intergenic
1023902178 7:44490366-44490388 GTCTGGGGAGCCGCCGCCCCCGG - Intronic
1024639344 7:51316814-51316836 GGCGGGGGCGCCGGGAGCGCAGG + Intronic
1024965380 7:55019121-55019143 GTCTGGGCGGCGGCGGCCGCCGG - Exonic
1026900469 7:74034099-74034121 TTAGGAGGCGCCGGGGCCGCAGG - Intronic
1028621485 7:92833563-92833585 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1029109565 7:98205725-98205747 GCCTGGGAGGCCGCGGCCGCGGG - Exonic
1029640333 7:101816183-101816205 GCCGGGGGGCCCGCGGCGGCGGG + Intronic
1033595214 7:142854491-142854513 GTAGGGGGAGCCGAGGCAGCGGG - Intergenic
1034174751 7:149091268-149091290 GCCGGGGGCGCGGAGGCCGTGGG + Intergenic
1034217979 7:149422466-149422488 GGTGAGGGCGCCGCGGCCTCCGG + Intergenic
1034911585 7:155002718-155002740 GTCGGGTCCGCCGAGGCCGCTGG - Intronic
1035153338 7:156893005-156893027 GACGCGGGCGGCGCGGCGGCGGG - Exonic
1035153399 7:156893206-156893228 GTCGGGGGCGGGGCGGGGGCGGG + Exonic
1035266549 7:157692849-157692871 CTCGGGGGCGGCGCGGCGGCGGG + Intronic
1035725801 8:1824214-1824236 GTCGGGGGCGCAGCCACCTCCGG - Intronic
1035725826 8:1824291-1824313 GCCGGGGGCGCCGCGGAAGGGGG - Intronic
1036723697 8:11200976-11200998 GCCGGAGCCGCCGCCGCCGCAGG - Exonic
1037273833 8:17156863-17156885 GCTGGGGGCGCCGCGGCGGGGGG - Intronic
1037811389 8:22089164-22089186 GCCGGGGCCGCCGGGGCCACGGG + Intronic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1038002496 8:23403716-23403738 GCCGGGCGCGGCGCGGCTGCTGG - Intronic
1039463159 8:37762737-37762759 GGCTGTGGCGCGGCGGCCGCGGG + Exonic
1039554868 8:38468325-38468347 GTCGGGCACGCCGCGGCGCCGGG - Intronic
1039893783 8:41701921-41701943 GTCGGAGGCGCCGCGCCCGACGG - Intronic
1039921228 8:41895966-41895988 CTCGGGCGCGCCGCACCCGCTGG - Intronic
1043388278 8:79768397-79768419 GGCGGGGGCTGGGCGGCCGCCGG + Intergenic
1044999814 8:97869430-97869452 GTCGAAGGCGCCGGGGCCCCGGG - Intronic
1045336109 8:101205597-101205619 GGCGGGCGCGCGGCGGCGGCGGG - Intronic
1047274661 8:123396466-123396488 GGCGCGCGCGCTGCGGCCGCTGG - Intronic
1047292289 8:123541113-123541135 GACGGGGGCGGCGGGGCGGCGGG + Exonic
1049509039 8:143018600-143018622 GGCGGGGGCGTCCCGGCCGGGGG - Intronic
1049548567 8:143246221-143246243 GCCGTGGGCGCCGCGGAGGCGGG + Intergenic
1049708172 8:144052250-144052272 GTGGCGGGCGGCGCGGGCGCGGG - Exonic
1049788524 8:144462611-144462633 GGCGGGGGCGGCCCGGCCGCGGG - Intronic
1049844201 8:144792215-144792237 GTGGTGGGCGCGGCGGCCTCGGG - Intronic
1049936563 9:505361-505383 GGCGTGGGCGCTGCGGCCTCTGG + Intronic
1051170173 9:14313779-14313801 GCCGAGGCCGCCGCCGCCGCCGG + Intronic
1051174010 9:14346111-14346133 GGGGGGCGCGCCGCGGGCGCGGG + Intronic
1053001156 9:34577958-34577980 GGCGGGGGCGTCGCGGCGGCGGG + Intronic
1053306154 9:36986133-36986155 GGCGCGGGCGCGGCGGCAGCCGG - Intronic
1056992368 9:91423781-91423803 GGCGGGCGCGCCGGGTCCGCGGG + Exonic
1057436862 9:95048557-95048579 GTCCCGGCCGCCGCGGCCGGAGG - Intronic
1057600048 9:96450123-96450145 GGCGGCGGCGCCGCGGGGGCGGG + Intergenic
1058866654 9:109167178-109167200 AGCGGGGGCGCCGCGGGCGCGGG + Exonic
1059191765 9:112333648-112333670 GGCGGGGGCGCGGCGGTGGCGGG - Intronic
1059305390 9:113349731-113349753 GCCGGGGGCACCGCATCCGCCGG + Exonic
1060272903 9:122159708-122159730 GACGGGGGCGACGCGGCTGAGGG - Exonic
1060549380 9:124477820-124477842 CCCGCGGGCGCCGCGGCTGCAGG + Intronic
1060555277 9:124504736-124504758 CTCGGCCGCGCCGCCGCCGCCGG + Intronic
1060811080 9:126611849-126611871 GGCGGGGGCGCGGCTGCTGCAGG - Intergenic
1060827471 9:126695234-126695256 GTGGGGGTCCCCGAGGCCGCTGG - Intronic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1061052250 9:128203737-128203759 GTGGGGGGCGCGCCGGCCGCGGG - Intronic
1061450198 9:130663557-130663579 GGCGGGGCCGCAGCGGCCGTCGG - Intergenic
1061502019 9:131009404-131009426 CACGTGGGCGCCGCGGGCGCGGG + Exonic
1062098946 9:134718004-134718026 GGCTGGGGGGCCGCGGCCACGGG + Intronic
1062341420 9:136095320-136095342 GGCGGGGGCGGGGCGGCGGCGGG + Intergenic
1062435957 9:136546649-136546671 GATGGGGGCGCCGCGGCCTCTGG + Intergenic
1062491715 9:136808094-136808116 TCCGGGGGGGCCGGGGCCGCCGG + Exonic
1062537750 9:137028287-137028309 GTCGCTGTCGCCGCGGCCGCCGG - Intronic
1202790862 9_KI270719v1_random:89683-89705 GGCGGCGACGCCGCGGCTGCGGG + Intergenic
1203469640 Un_GL000220v1:110967-110989 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203477461 Un_GL000220v1:154939-154961 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1185610736 X:1392518-1392540 GGCGGGGTCGCCGCGGCCTCCGG - Exonic
1186829855 X:13379303-13379325 GACTGGGCCGCCGCCGCCGCTGG + Intergenic
1187419543 X:19122527-19122549 GGGGGCGGCGCCGAGGCCGCGGG - Exonic
1196707347 X:118727705-118727727 GGCGGGGGCGCCGCGCCTACGGG + Exonic
1196800618 X:119540046-119540068 GTGGGGGGCGCTGGGGCTGCTGG - Intronic
1198518350 X:137429435-137429457 GTAGGGGGCGCTGCGGCAGGGGG - Intergenic
1201895923 Y:18992920-18992942 TTCGGGGAGGGCGCGGCCGCGGG - Intergenic