ID: 1028768272

View in Genome Browser
Species Human (GRCh38)
Location 7:94585061-94585083
Sequence TGGGTTGCTCAACTGGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028768268_1028768272 3 Left 1028768268 7:94585035-94585057 CCACAAGAGTTAAAGTATTATTT 0: 1
1: 0
2: 1
3: 56
4: 1167
Right 1028768272 7:94585061-94585083 TGGGTTGCTCAACTGGAACACGG 0: 1
1: 0
2: 1
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028768272 Original CRISPR TGGGTTGCTCAACTGGAACA CGG Intergenic
901515730 1:9744581-9744603 TGGATCCCTCAACTGGACCATGG - Exonic
903765245 1:25729817-25729839 TGGGTTCCTCATCTAGAAAATGG - Intronic
906172371 1:43737950-43737972 CAGTTTGCTCAACTGGAAAATGG - Intronic
906196921 1:43935378-43935400 TTGTTTGCTCATCTGGAAAAAGG + Intronic
906343305 1:44999500-44999522 TAGGTTTCTCATCTGGAAAAGGG + Intergenic
907251408 1:53142159-53142181 TGGTTTTCTCATCTGTAACATGG - Intronic
908403772 1:63794359-63794381 CGGGTTCCTCACCTGGAACATGG - Intronic
908704174 1:66932280-66932302 TGGATTGTTCAACTGCAAGAAGG + Intronic
908766951 1:67562826-67562848 GGGGTTGCTTGACTGGACCAAGG + Intergenic
910854353 1:91679954-91679976 TGGCTTGGACAACTGGAAGACGG + Intergenic
912566531 1:110591700-110591722 AGGGTTTCTAATCTGGAACAAGG - Intergenic
915192044 1:154159339-154159361 TGGGTTGAGAAACTGAAACAAGG + Intronic
915495734 1:156281773-156281795 TGGGTAGGTCAACTGGAACATGG - Intronic
918128251 1:181603296-181603318 TGGTTTTCTCAACTGTAAAATGG - Intronic
919778023 1:201206682-201206704 TGGGATGCTCGACTGGGACCTGG + Exonic
921650694 1:217674590-217674612 TGTGTTGCCCAAGGGGAACACGG + Intronic
1065805427 10:29389671-29389693 TGGTTTGCTCACCTGTAAGATGG + Intergenic
1067711743 10:48656013-48656035 GGGGCTGCTCACCTGGAACCAGG + Intronic
1069835649 10:71306412-71306434 TGGGTTGTTGAACTGGAGCACGG - Intergenic
1070536830 10:77385010-77385032 TGGTTTTCTCACCTGTAACATGG + Intronic
1072089158 10:92110044-92110066 TGGTTTCCTCACCTGGAAGATGG - Intronic
1075197932 10:120377537-120377559 TGGGTTACTTCACTGGAAGAGGG - Intergenic
1076168501 10:128301307-128301329 TGGTTTTCTCATCTGTAACATGG + Intergenic
1077680334 11:4234163-4234185 CGGTTTGCTCATCTGGAAAATGG - Intergenic
1077681149 11:4241743-4241765 CGGTTTGCTCATCTGGAAAATGG + Intergenic
1077684613 11:4279583-4279605 CGGTTTGCTCATCTGGAAAATGG - Intergenic
1077685429 11:4287186-4287208 CGGTTTGCTCATCTGGAAAATGG + Intergenic
1077690581 11:4338347-4338369 CGGTTTGCTCATCTGGAAAATGG + Intergenic
1078341304 11:10499557-10499579 TGGTTTGCTCAATTGTAAAATGG + Intronic
1078479147 11:11660943-11660965 TGGTTTCCTCATCTGGAAAAGGG + Intergenic
1080344787 11:31312333-31312355 TGGTTTACTCATCTGGAAAAGGG - Intronic
1085107154 11:73854964-73854986 TGGTTTCCTCAACTGTAAAATGG + Intronic
1085430105 11:76440534-76440556 TGGTTTCCTCAACTGTAAAATGG + Intergenic
1086750533 11:90488421-90488443 TGGCTTCCTCATCTGGAAAATGG + Intergenic
1088526208 11:110758400-110758422 TGGTTTTCTCAACTGTAAAATGG - Intergenic
1089304744 11:117519433-117519455 TGGCTTCCTCACGTGGAACACGG + Intronic
1092708034 12:11305946-11305968 TGGGTTGCTCAACTTGGTGATGG + Intergenic
1093056755 12:14563708-14563730 TGGTTTCCTCAACTGGAAGATGG - Intronic
1096480641 12:51938579-51938601 TGGGATCCTCATCTGTAACATGG - Intergenic
1096481336 12:51943207-51943229 TGGGTTCCTCATCTGTAACATGG - Intergenic
1099232528 12:80043745-80043767 TGGTTTCCTCATCTGGAAAATGG + Intergenic
1099261406 12:80387193-80387215 TGATTTGATCAACTGGAAGAAGG + Intergenic
1099729120 12:86475177-86475199 TAGGTTCCTCAACTGCAAAATGG + Intronic
1101978384 12:109383090-109383112 TGGGTTGCCCCACAGAAACATGG - Intronic
1102229558 12:111253083-111253105 TGGGTTGTTCTCCTGGAACTCGG + Intronic
1106467381 13:30025012-30025034 TGGGTTTCTCATCTGTAAAATGG - Intergenic
1106559586 13:30836855-30836877 TGGATTGCTAAACTGGGTCATGG - Intergenic
1109228512 13:59726541-59726563 TGAGTTGGTTAACTGGACCAGGG - Intronic
1111959032 13:94789454-94789476 TGGTTTCCTCATCTGGAAAAAGG + Intergenic
1113072590 13:106435833-106435855 TAGGCTACTCAACTAGAACATGG + Intergenic
1114408483 14:22478459-22478481 GGGGTTGGTCAACAGGACCACGG + Intergenic
1114814353 14:25939060-25939082 TGGGTTACTCAGTTGGAACATGG + Intergenic
1117874757 14:60240601-60240623 TGGTTTCCTCTTCTGGAACAGGG - Intergenic
1118058165 14:62104792-62104814 TGGTTTCTTCAACTGGAAAATGG + Exonic
1119587936 14:75855537-75855559 TGGCTTGGTGAACTGGAAGATGG + Intronic
1120923487 14:89775723-89775745 TTGGTTGTTCAACTGCAAAATGG - Intergenic
1122236992 14:100336941-100336963 GGAGGTGCTCAACTGAAACAAGG - Intronic
1123892885 15:24799004-24799026 TGGGATTCTGAAATGGAACATGG - Intergenic
1124854177 15:33371211-33371233 AGGGTTGCTCAGCTGGAAACTGG + Intronic
1128212846 15:65914430-65914452 TGGTTTGCTCATTTGTAACATGG + Intronic
1129650365 15:77482719-77482741 ATTGTTGCTGAACTGGAACAGGG + Intronic
1131064279 15:89423612-89423634 CTGGTTCCTCATCTGGAACAGGG - Intergenic
1131207762 15:90465852-90465874 TGGGTTAGTCAAATGGAAGAAGG - Intronic
1132953900 16:2580905-2580927 TGGGTTGTCTCACTGGAACAGGG + Intronic
1132960445 16:2619258-2619280 TGGGTTGTCTCACTGGAACAGGG - Intergenic
1135565235 16:23506756-23506778 TTGGGTGCTCAAGTGGAACAGGG - Intronic
1138115280 16:54356191-54356213 AGAGTTGCCCAACTGGTACATGG + Intergenic
1139033587 16:62915655-62915677 TGGGTTTCTCAGCTGTCACAAGG - Intergenic
1139705697 16:68738756-68738778 CGGTTTGCTCAACTGTAAAACGG - Intronic
1143379442 17:6486896-6486918 TGGTTTGCTCATCTGTAAAATGG - Intronic
1147458112 17:40551320-40551342 TGGGTTTCTCAACTGCAAAATGG - Intergenic
1147557618 17:41489368-41489390 TGGGCTGCTCAGCTGGAAAGGGG + Intronic
1147649970 17:42056269-42056291 TGGTGTGCTCAACTGAAAAATGG - Intronic
1149415025 17:56449960-56449982 TGGGCTGTTCAATTGGGACAGGG + Intronic
1150631650 17:66884565-66884587 TGAGATGCTCAACAGGACCAAGG + Exonic
1153894982 18:9550676-9550698 TAGTATGTTCAACTGGAACATGG + Intronic
1156028230 18:32681937-32681959 CAGATTGCTCATCTGGAACATGG + Intronic
1158983381 18:62787898-62787920 TGGGTTGGTTAAGTGGAACTTGG + Intronic
1160227742 18:77024543-77024565 TGTGTTGCTCAGATGAAACATGG + Intronic
1161429209 19:4221549-4221571 TGGTTTGCTTATCTGGAAAATGG - Intronic
1162389351 19:10380039-10380061 TGGTTTCCTCATCTGGAAAATGG + Intronic
1168598719 19:57700844-57700866 TGTGTAGCTCAACAGGGACAGGG - Exonic
926063479 2:9819684-9819706 GGGGTTGCTCCTGTGGAACAGGG - Intergenic
926621074 2:15047872-15047894 TGGGTTCCTCAACTGTAAAATGG + Intergenic
926725994 2:15998418-15998440 TGGCTTCCTCAACTGTAAAATGG - Intergenic
928416348 2:31095286-31095308 TTGGTAGCACAACTGGAGCAAGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929976384 2:46639441-46639463 AGTGTTTCTCAACTGGAATATGG - Intergenic
931422467 2:62141058-62141080 TTGATTACTCAAGTGGAACAAGG + Intronic
934603992 2:95680654-95680676 TCAGTTTCTCAACTGGAAAATGG - Intergenic
934858339 2:97742783-97742805 TGGTTTCCTCAACTGTAAAATGG - Intergenic
936537376 2:113322883-113322905 CAGGTTTCTCAACTGGAAAATGG - Intergenic
937501080 2:122480012-122480034 TGGTTTCCTCATCTGGAAAATGG + Intergenic
940111408 2:150158830-150158852 TGGTTTTCTCTCCTGGAACACGG - Intergenic
945665663 2:212738475-212738497 TGGTTTCCTCATCTGGAAAATGG + Intergenic
947067726 2:226249107-226249129 AGGTTTCCTCAACTGGAAAAGGG - Intergenic
947288701 2:228547061-228547083 TGGGTTGCAAAACTGGCAAAAGG - Intergenic
948132621 2:235611852-235611874 TATGTTCCACAACTGGAACAGGG - Intronic
948565341 2:238882851-238882873 TGGGTTGCTCTGCTGGAAGCTGG + Intronic
1170207295 20:13812151-13812173 TGTGTTGCCCATCTGTAACAAGG + Intronic
1170746423 20:19103197-19103219 TGGGTTGCTCAGCTGGACTTGGG + Intergenic
1170990630 20:21298820-21298842 TGGGTTGGTTGACTGAAACATGG - Intergenic
1171722630 20:28579533-28579555 TGGTTTTCACAACTGGAATACGG - Intergenic
1171755449 20:29103913-29103935 TGGTTTTCCCAACTGGAATACGG + Intergenic
1171787232 20:29478971-29478993 TGGTTTTCACAACTGGAATACGG - Intergenic
1174087706 20:48020710-48020732 TGGGATGCACAGCTGGAAGAAGG + Intergenic
1174128343 20:48325127-48325149 TGGGCTGCACAGCTGGAAGAAGG - Intergenic
1174412160 20:50343348-50343370 TGGTTTCCTCATCTGTAACATGG - Intergenic
1175133049 20:56803864-56803886 TGGCTTTCTCATCTGTAACATGG - Intergenic
1175390978 20:58627259-58627281 TGGTTCACTCAACTGGAACTGGG - Intergenic
1175787123 20:61718701-61718723 TAGCTTACTCAACTGAAACAGGG + Exonic
1180296187 22:10938211-10938233 TGGTTTTCCCAACTGGAATACGG - Intergenic
1180412485 22:12627793-12627815 TGGTTTTCCCAACTGGAATAAGG + Intergenic
1182300339 22:29333493-29333515 TGGGCTTCTCAGCTGGAGCAGGG + Intronic
1183018003 22:35005854-35005876 TGGGTTGCTCATCTCTAAAAAGG + Intergenic
1184279952 22:43431646-43431668 TGGTTTGCTCACCTGTAAAATGG + Intronic
950151084 3:10688096-10688118 TGGTTTTCTCACCTGGAAAATGG - Intronic
950398321 3:12751084-12751106 TGGGTTTCTCATCTGTAAAACGG + Intronic
950702985 3:14762852-14762874 TGGGTTGCCCCACTCGGACAAGG - Intronic
950838837 3:15947493-15947515 TAGTTTGCTCAACTGTAAAATGG + Intergenic
951453417 3:22864606-22864628 TAGGTTGAGCAACTGGAAGAAGG + Intergenic
952931608 3:38365184-38365206 TGGGTTTCCCAACAGCAACACGG + Exonic
952932423 3:38370640-38370662 CGGTTTCCTCATCTGGAACAAGG + Intronic
955110254 3:55942098-55942120 TGGGTTGCACAAATGGCACTGGG + Intronic
955547965 3:60051919-60051941 TGGGTATCTCCATTGGAACAGGG + Intronic
955731824 3:61995493-61995515 ATGGTTGCTCAAGTGTAACACGG + Intronic
961619604 3:128213230-128213252 TAGGCTCCTCACCTGGAACATGG + Intronic
961924475 3:130463004-130463026 TGGTTTGCTCATCTGTAAAATGG + Intronic
962189816 3:133298686-133298708 TGGTTTCCTCACCTGTAACATGG - Intronic
962276124 3:134014826-134014848 TGGTTTCCTCAACTGTGACATGG + Intronic
969272181 4:6110497-6110519 TGGCTTGCTCACCTGTAACACGG + Intronic
974873316 4:67671762-67671784 GGGGTTGTTCCACTGGAAAAAGG - Intronic
978467587 4:109025834-109025856 TGGTTTGTTCAACTGCAAAATGG - Intronic
981267823 4:142807401-142807423 TGTGTTGCTAAACTGGAAAGTGG + Intronic
982906274 4:161078176-161078198 TGGTTTGCTCATGTGAAACATGG + Intergenic
982943239 4:161585205-161585227 TGGGTTTCCCAGCTGGAGCATGG + Intronic
984226738 4:177044364-177044386 TGAGGTGCTCAGCTGAAACACGG + Intergenic
985111230 4:186547540-186547562 TGAGGTGCTCAGATGGAACAGGG - Intronic
985621027 5:956280-956302 TGGCTTCCTCATCTGGAAAATGG + Intergenic
986827662 5:11539550-11539572 TGACTTGCTCATCTGGTACATGG - Intronic
990905967 5:60803292-60803314 TGGGTAGCTCACATGGAAGAAGG + Intronic
996644132 5:125794173-125794195 TTGTTTGCTCAAATGTAACAGGG + Intergenic
998222135 5:140291955-140291977 TGTGTTACTCTACTAGAACAAGG - Intronic
998714378 5:144866039-144866061 TGGGTTTCTTAAGTGGAAAATGG - Intergenic
999306381 5:150522121-150522143 TGGTTTGCTCATCTGAAAAATGG - Intronic
999926160 5:156380696-156380718 TGGTTTGCTCATCTGTAAAATGG + Intronic
1000637050 5:163656375-163656397 TGGCTAGCCTAACTGGAACACGG + Intergenic
1001273820 5:170335843-170335865 TGGTTTTCCCATCTGGAACATGG + Intergenic
1006727193 6:36208044-36208066 TGGTTTTCTCACCTGGAATATGG + Intronic
1007464588 6:42043081-42043103 TGGTTTGCTCACCTGCAAAATGG + Intronic
1008234563 6:49028455-49028477 TGGTTTTCTCAACTGGACAATGG - Intergenic
1008749309 6:54713019-54713041 TGGTTTGCTCATCTGTAAAATGG - Intergenic
1010362742 6:75013671-75013693 TGATTTGATCAACTGGAAGAAGG + Intergenic
1011401772 6:86970373-86970395 TGGTTTGCTCACCTGTAAAATGG + Intronic
1011779831 6:90775436-90775458 TGGTTTTCCCAACTGGAAAATGG + Intergenic
1013707080 6:112849309-112849331 TGGGTGGGACATCTGGAACAGGG + Intergenic
1015946100 6:138502752-138502774 TGGTTTGCTCATCTGTAAAACGG + Intronic
1017894686 6:158668846-158668868 TGGCATGCTGAACTGGATCACGG + Intronic
1018087696 6:160319177-160319199 AGGGTTGGTCAACAGGCACAAGG - Intergenic
1018425414 6:163675704-163675726 TGAGGTGCTCAAATTGAACATGG + Intergenic
1018426990 6:163692057-163692079 TGGCTTACTCAACTGGGAAATGG - Intergenic
1020921754 7:14274085-14274107 TGCTTTGCTCAACTGCAAGACGG + Intronic
1023807705 7:43885603-43885625 TGGTTTCCTCAAATGAAACAGGG + Intronic
1024516926 7:50267136-50267158 TACATTGCTCAACTGGAACTGGG + Intergenic
1024666366 7:51551006-51551028 TGGTTTCCACAACTGGAACAGGG - Intergenic
1027127240 7:75565473-75565495 TCGGCTTCTCAAATGGAACAGGG + Intronic
1027799540 7:82734295-82734317 TGGGTTGGTGAACTGAAACATGG + Intergenic
1028768272 7:94585061-94585083 TGGGTTGCTCAACTGGAACACGG + Intergenic
1029203813 7:98856367-98856389 CGGTTTGCTCATCTGGAAAATGG - Intronic
1032347624 7:131131544-131131566 TGGTTTGCTCATCTGTAAAATGG - Intronic
1033157920 7:138972245-138972267 TGAGTTGTTGAAGTGGAACATGG - Intronic
1036126067 8:6063477-6063499 TGGGTTGCACAACTGGCAAGAGG - Intergenic
1036382833 8:8249485-8249507 TGGGTTCCACATCTGGAGCAGGG + Intergenic
1037477205 8:19269653-19269675 TGTGCTGCTCAACTGACACACGG - Intergenic
1040075413 8:43224374-43224396 AGGATTACTCAACTGGTACATGG + Intergenic
1046815189 8:118575587-118575609 TGGGTTTCTCAGCTGTAAAATGG + Intronic
1047174358 8:122526602-122526624 TGGGCTGTTCACCTGGAGCAGGG - Intergenic
1050180266 9:2915116-2915138 TGTGTTTCTGAACTAGAACAAGG - Intergenic
1050256075 9:3793519-3793541 TGGTTTGCTCATCTGCAAAATGG - Intergenic
1051105286 9:13572174-13572196 TGGGTTTCTCATCTGCAAAATGG + Intergenic
1054990952 9:71326313-71326335 TAGGTTCCTCATCTGTAACATGG - Intronic
1056556899 9:87697179-87697201 TGGGTTCTTCAACTGGGACAAGG - Exonic
1059701809 9:116782311-116782333 TGGGTCGCTGAACTGGTACTTGG - Intronic
1060206495 9:121685502-121685524 TGGGATCCTCAACTGTAAAATGG - Intronic
1061370532 9:130195142-130195164 TGGTTTGCTCATCTGTAAAATGG - Intronic
1202803039 9_KI270720v1_random:19245-19267 TGGTTTTCCCAACTGGAATACGG - Intergenic
1203447833 Un_GL000219v1:76458-76480 TGGTTTTCACAACTGGAATACGG - Intergenic
1187820827 X:23286222-23286244 TGGTTTCCTCAACTCTAACATGG + Intergenic
1188182251 X:27070684-27070706 TGTTTTGCACAAGTGGAACAAGG - Intergenic
1189857062 X:45234028-45234050 TGGGTAGCTAAACCAGAACAAGG + Intergenic
1193644666 X:84052977-84052999 TGGGTTCCTCCCATGGAACATGG - Intergenic
1197297714 X:124739380-124739402 TGGGTTTCTCATCTGTAAAATGG - Intronic