ID: 1028774967

View in Genome Browser
Species Human (GRCh38)
Location 7:94665659-94665681
Sequence TACAGGGTACTGTAAGATGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028774967_1028774971 -1 Left 1028774967 7:94665659-94665681 CCTCCATCTTACAGTACCCTGTA 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1028774971 7:94665681-94665703 AAATACCTGTCATGTCCTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028774967 Original CRISPR TACAGGGTACTGTAAGATGG AGG (reversed) Exonic
902492489 1:16794624-16794646 TACAGGCTACTATTAGCTGGTGG + Intronic
904371111 1:30047909-30047931 TATATGGTACTGTAGGAAGGTGG + Intergenic
907371379 1:54005729-54005751 AACAGGGGACAGTAAGGTGGGGG - Intergenic
908693456 1:66809125-66809147 TGCAAGGGACTGGAAGATGGTGG + Intergenic
909524376 1:76606548-76606570 TACTGGGTCCTGTCAGAGGGTGG + Intronic
911041584 1:93595114-93595136 TACAGGGTACTATAGGAGGTAGG + Intronic
912267631 1:108174592-108174614 TTCTGGGTACTGGAGGATGGTGG - Intronic
915544125 1:156586294-156586316 GACAGGGTGCTGCAGGATGGGGG + Intronic
918988598 1:191666517-191666539 TTCAGGTAGCTGTAAGATGGTGG + Intergenic
923527959 1:234787908-234787930 TACAGGCTACTATTAGCTGGTGG - Intergenic
1073992669 10:109280823-109280845 TACAGGGTATTCTTAGAGGGTGG + Intergenic
1074563293 10:114553606-114553628 TACAGGATCCTGTTAGAAGGAGG + Intronic
1079938950 11:26653653-26653675 TACTGGGGACTGTGAGAGGGCGG - Intronic
1080475861 11:32590466-32590488 TAGAGGGTGCTGTAAAAGGGAGG - Intronic
1081081540 11:38746606-38746628 TACAGGCCAATGTTAGATGGAGG + Intergenic
1081385171 11:42463716-42463738 TACAGGGTACTTAAAGAGGAAGG - Intergenic
1084578217 11:70004539-70004561 TCCAGGCCACTGTCAGATGGGGG + Intergenic
1084585241 11:70057403-70057425 TTCAGGGTACTCTAAGGAGGTGG - Intergenic
1085324810 11:75598407-75598429 TACAGGGTAATCTAAGAGGTTGG - Intronic
1096002310 12:48140095-48140117 TCCAGGGTACACTAAGAAGGGGG - Intronic
1096669429 12:53189784-53189806 TACAGGGTACTGGAAGATGTGGG - Exonic
1097464577 12:59906582-59906604 TACAGGGCACTCTTGGATGGTGG - Intergenic
1100991861 12:100260019-100260041 TACAGGCTACTGTAAAATCATGG + Intronic
1105718221 13:23088427-23088449 CACAGGGTTTTGTCAGATGGTGG + Intergenic
1106671766 13:31913701-31913723 TTCAAGGTACTGTAAGAAGCTGG + Intergenic
1107744306 13:43488805-43488827 AACAGGGTACTGGAAGCTAGAGG + Intronic
1109351347 13:61186412-61186434 TCTAGGGTACTGCAAGATGTGGG - Intergenic
1110320840 13:74158300-74158322 TAAAGGGGGGTGTAAGATGGAGG + Intergenic
1115977147 14:39009249-39009271 TACAGGCCAGTGTTAGATGGAGG - Intergenic
1116119668 14:40706127-40706149 TACTGGGCTCTGGAAGATGGTGG + Intergenic
1117783465 14:59258318-59258340 TTCAGGGTATTGGGAGATGGGGG + Intronic
1120552796 14:85891815-85891837 TGCAGGGTATTGTAAGAATGGGG + Intergenic
1121611563 14:95284415-95284437 TTCTGGGTTCTGGAAGATGGTGG - Intronic
1125906486 15:43397659-43397681 TACAGGGGACACTAAGAAGGGGG - Intronic
1133178078 16:4031120-4031142 TAAAGGATACTGTTAGATGCTGG + Intronic
1138794066 16:59946292-59946314 TACATGGTGCTGTCAGATGTTGG + Intergenic
1152794278 17:82299221-82299243 TACAGGTTTCTATAAAATGGGGG + Intergenic
1158739661 18:60125729-60125751 TACAGGCCAATGTTAGATGGAGG + Intergenic
1168373421 19:55855521-55855543 TTCAGGGGACTGAAAGATTGGGG + Intronic
924968470 2:100739-100761 TAGAGGGAACAGAAAGATGGAGG + Intergenic
930854232 2:55995287-55995309 AACAGGGTACTGAAAAATTGAGG + Intergenic
933031445 2:77333790-77333812 TTCTGGGTTCTGGAAGATGGTGG - Intronic
936076405 2:109404469-109404491 GACAGGGGACAGAAAGATGGGGG + Intronic
942833213 2:180261947-180261969 TACAGGTGAATGTAATATGGGGG - Intergenic
943464511 2:188212219-188212241 TCCAGGGTAATGCAAGATGGTGG + Intergenic
1171110741 20:22479734-22479756 TACAGGGTCCTGTCAGAGTGGGG + Intergenic
1172079211 20:32326007-32326029 TATAGGGTACTGTGAGAAAGAGG - Intronic
1173207880 20:41008635-41008657 TACAGGGGAATGTGAGAAGGAGG - Intergenic
1174084792 20:47999368-47999390 TACAGGGTGCCCTTAGATGGGGG - Intergenic
1175463615 20:59173881-59173903 TATAGGGTACCCTAAGATTGAGG + Intergenic
1178091670 21:29169988-29170010 TTCAGTGTAATGTAATATGGGGG - Intronic
1179582453 21:42352173-42352195 GACAGGGGCCTGAAAGATGGGGG - Intergenic
1179582486 21:42352279-42352301 GACAGGGGCCTGAAAGATGGGGG - Intergenic
1181504284 22:23341117-23341139 TACAGGGTACTGAAATCTGGAGG + Intergenic
1181655393 22:24293728-24293750 CACAGGGTACTGAAATCTGGAGG + Intronic
1181709272 22:24671351-24671373 CACAGGGTACTGAAATCTGGAGG + Intergenic
1183844297 22:40528122-40528144 TACAGAGTAAGATAAGATGGAGG + Intronic
951110824 3:18801956-18801978 TTCAGGGTAAGGTCAGATGGGGG - Intergenic
951325346 3:21296156-21296178 TAGAGGGTACTCTAAGATACAGG + Intergenic
951785670 3:26416091-26416113 TACAGGGTATTGGTAGCTGGAGG + Intergenic
952696185 3:36267447-36267469 TTGGGGGTACTGTAAGATGGTGG - Intergenic
952826913 3:37531808-37531830 TGCAGGGTGCTGCAGGATGGTGG + Intronic
953521519 3:43647649-43647671 TACAGAGTAGTGTAATATGATGG - Intronic
959560864 3:107779194-107779216 TAAAGGGGATTGTAAGAGGGTGG + Intronic
959619621 3:108385919-108385941 TACATGGTACTTTAAGGTGGTGG - Intronic
962146066 3:132841292-132841314 TACAGGACACTGGGAGATGGTGG - Intergenic
962876493 3:139539496-139539518 CACTGGGTACTGGAAGATGTTGG - Exonic
964192882 3:154025438-154025460 TACATGGTACAGTAAGTTAGGGG - Intergenic
964530158 3:157658798-157658820 TGCAGGGAAATGGAAGATGGAGG - Intronic
968276025 3:197441030-197441052 CACAGGGGACAGTAAGAGGGTGG - Intergenic
968962477 4:3752626-3752648 TGCAGGGTCCTGGAAGACGGTGG + Intergenic
969833940 4:9823307-9823329 TACAGGGTGCTGTAAGCGGCTGG + Intronic
977344977 4:95806492-95806514 TACAGGGTACTGTATGAGTTAGG + Intergenic
981969412 4:150648721-150648743 TACAGGGGACAGTAAGTTTGGGG + Intronic
983363975 4:166762603-166762625 TACAGGGTTCTGTAAGTTGAAGG + Intronic
984397423 4:179219674-179219696 TACAGGGTAATGTAAGGAAGGGG - Intergenic
987098910 5:14575243-14575265 TAAAGGGAACTGAAAGATGTGGG - Intergenic
987111951 5:14696567-14696589 TCCAAGGAACTGTAAGAAGGAGG + Exonic
991256864 5:64623572-64623594 TGCAGGAAACTGTAACATGGTGG + Intergenic
993098223 5:83505649-83505671 TTCTGGGTTCTGGAAGATGGTGG + Intronic
993531108 5:89026843-89026865 TTCTGGGTTCTGGAAGATGGTGG + Intergenic
994003243 5:94806125-94806147 TTCAGAGTCGTGTAAGATGGTGG - Intronic
999077273 5:148808033-148808055 TACTGGTTACTGGAAAATGGAGG - Intergenic
1000040037 5:157478706-157478728 TACTGTGAACTGGAAGATGGTGG - Exonic
1005757795 6:28940809-28940831 TGCAGGGAAGTGTAAGAAGGGGG + Intergenic
1009402918 6:63277644-63277666 CACAGGGTACAGTAATAAGGTGG - Intronic
1009675172 6:66810652-66810674 TTCAGGGAACAGTAAGCTGGAGG - Intergenic
1010916938 6:81631651-81631673 TACAGGGTCGTGTATGAAGGTGG - Intronic
1011660231 6:89588548-89588570 TACTGGGGACTGTAACAAGGAGG - Intronic
1012056049 6:94411609-94411631 CACAAGGCAGTGTAAGATGGGGG + Intergenic
1012774151 6:103480959-103480981 TACAGGGTACAGTATCACGGGGG + Intergenic
1020895312 7:13931721-13931743 TACAGGGTTCAGAAAGCTGGCGG + Exonic
1024155657 7:46621126-46621148 TACCAGGTACTATAATATGGTGG + Intergenic
1028774967 7:94665659-94665681 TACAGGGTACTGTAAGATGGAGG - Exonic
1029526234 7:101095685-101095707 CACAGGGCATTGTAAGATGGAGG + Intergenic
1030910851 7:115247109-115247131 TACTGGGGACTGTCAGAGGGTGG - Intergenic
1036998512 8:13688929-13688951 TAAAGGGAACTTTAGGATGGTGG - Intergenic
1038686787 8:29726182-29726204 TACATGGTACTGTGTGGTGGGGG + Intergenic
1040724623 8:50368180-50368202 AACAGGCCACTGTAAGCTGGAGG + Intronic
1043925090 8:86027714-86027736 CACAGGGGACTATTAGATGGGGG - Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1047642702 8:126837675-126837697 TACAGTTTAGTTTAAGATGGAGG + Intergenic
1048088634 8:131213580-131213602 TACAGGAGACTGTCAGATGCTGG + Intergenic
1048508533 8:135042210-135042232 TACAGGCCACTGTCAAATGGGGG - Intergenic
1059471342 9:114506621-114506643 TCCAGGGTAGGGCAAGATGGAGG + Intergenic
1187722590 X:22166803-22166825 AACAGAGTACAGTAGGATGGTGG - Intronic
1193677023 X:84467220-84467242 AGCAGGGAGCTGTAAGATGGAGG + Intronic
1194178832 X:90688346-90688368 TACCAGGTTCTGGAAGATGGTGG + Intergenic
1200525497 Y:4270516-4270538 TACCAGGTTCTGGAAGATGGTGG + Intergenic
1200691826 Y:6313176-6313198 TACAGGGTATTGGAAGAGGCAGG + Intergenic
1201043446 Y:9861547-9861569 TACAGGGTATTGGAAGAGGCAGG - Intergenic