ID: 1028781239

View in Genome Browser
Species Human (GRCh38)
Location 7:94738951-94738973
Sequence CAGTATCAGTAGTAGGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028781235_1028781239 10 Left 1028781235 7:94738918-94738940 CCCAAACAAATATATGTGATTAC 0: 1
1: 0
2: 3
3: 24
4: 312
Right 1028781239 7:94738951-94738973 CAGTATCAGTAGTAGGTTACTGG 0: 1
1: 0
2: 0
3: 2
4: 71
1028781236_1028781239 9 Left 1028781236 7:94738919-94738941 CCAAACAAATATATGTGATTACT 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1028781239 7:94738951-94738973 CAGTATCAGTAGTAGGTTACTGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028781239 Original CRISPR CAGTATCAGTAGTAGGTTAC TGG Intergenic
902069341 1:13720589-13720611 CAGAATCAGGACTTGGTTACTGG + Intronic
904110201 1:28120033-28120055 CAGTGTCAGTATTAAGCTACTGG + Intergenic
906235888 1:44209351-44209373 CAGCATCAGTAGTAAGGTACTGG + Intergenic
906685011 1:47757577-47757599 CAGTAGCAATACTGGGTTACAGG - Intergenic
919549928 1:198972312-198972334 CAGTAACAATAGTAGGGTTCAGG + Intergenic
920845468 1:209589639-209589661 CAGGAACAGTAGTAGGTTCTAGG + Intronic
922610070 1:226919981-226920003 TAGTAGCAGTAGTATTTTACTGG - Intronic
1064514860 10:16136093-16136115 CAGTATCCTTAGTAGGTTCTTGG + Intergenic
1065613825 10:27500169-27500191 CAGCATCATTTGTAGGTTGCAGG + Intergenic
1065772207 10:29088051-29088073 CAGTAACAGTAGAAGGTGAAGGG - Intergenic
1071498862 10:86189628-86189650 AAGTGTCAATAGTAGGTAACAGG - Intronic
1078040224 11:7854640-7854662 CATTATCAGGAGTCAGTTACAGG - Intergenic
1082965503 11:58962855-58962877 AAGTATCAGTAGTATGTTGGGGG + Intronic
1084987143 11:72885516-72885538 TAGTAGCAGTAGTAGGTATCAGG - Intronic
1087627197 11:100608630-100608652 CAATGTCAGTAGTAGTTTAATGG - Intergenic
1089623999 11:119739869-119739891 CAGCATCAGAAGTAGATTAAGGG - Intergenic
1093200640 12:16182312-16182334 CAGGATCACTACTAGGTTTCTGG - Intergenic
1093377327 12:18446344-18446366 CAGTCTCAGCAGGAGATTACAGG + Intronic
1097791183 12:63817365-63817387 CATTATCAGTAATGGGATACGGG + Intergenic
1107828288 13:44350478-44350500 CAGTATCTGTCGTATGTTCCTGG + Intergenic
1109346209 13:61117508-61117530 AAGTATCAGTAGTATGATAAGGG - Intergenic
1112939738 13:104847187-104847209 CAGTATAAGTAGTAATTTAATGG - Intergenic
1117062270 14:51975181-51975203 AAGTATCAGCAGTAGCTTCCAGG + Intronic
1118164292 14:63320996-63321018 CATTAACTGTAGTTGGTTACAGG - Intergenic
1125058816 15:35393922-35393944 TAGTATGAGTAGTAGTTTTCTGG + Intronic
1125762730 15:42108303-42108325 CAGTCTCAGCAGAAGGTTAAAGG + Intergenic
1127043626 15:55003162-55003184 CAGTATCAGAAGAAGATTATTGG + Intergenic
1134223628 16:12374883-12374905 CAGTATCACTAGAAGGCAACTGG - Intronic
1137699128 16:50483609-50483631 CAGTATTTGTAGTAGTTTTCTGG + Intergenic
1140706603 16:77636496-77636518 CAGCATCTGTAGTAGAATACAGG - Intergenic
1158832251 18:61292560-61292582 CAGGAGCAGAAGTAGGTCACTGG - Intergenic
1159697913 18:71584042-71584064 CAGTATCAAGAGTAGGATGCTGG - Intergenic
1164952847 19:32353109-32353131 TAGTATCAGCAGCAGGTGACTGG - Exonic
930925279 2:56810570-56810592 CAGTATCAGTGATCGGTAACTGG + Intergenic
931721488 2:65070400-65070422 CAGTATCATTGGGAGGTGACCGG + Intronic
943861724 2:192873809-192873831 GAGTATCATTACTAGATTACAGG - Intergenic
945766808 2:213990922-213990944 CAGCAACAGCAGTAGCTTACAGG + Intronic
1177284649 21:19033875-19033897 AGATATCAATAGTAGGTTACTGG + Intergenic
1178048869 21:28726993-28727015 CAATATCAGTACTAGTTCACAGG + Intergenic
1182896707 22:33864934-33864956 CAGGAGCAGAAGTAGGTTAAAGG - Intronic
949558370 3:5179106-5179128 CAGTGTCAGTATTAAGCTACTGG - Exonic
949976940 3:9469482-9469504 CTGAATCAGTAGTAGTTCACAGG + Intronic
953996086 3:47521140-47521162 CAGCATCAGTAGTGGGTGACTGG + Intergenic
977133942 4:93278170-93278192 AAGTTTCCATAGTAGGTTACTGG + Intronic
980089693 4:128429704-128429726 GATTATCAGTTGTAGGTTTCTGG + Intergenic
986946030 5:13021446-13021468 CAGTATTAGAATTTGGTTACTGG - Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993528987 5:89002459-89002481 CAATTGCAGTAGCAGGTTACTGG - Intergenic
994331460 5:98511462-98511484 TACTATTAGTAGTAGGTTAATGG - Intergenic
995766170 5:115622288-115622310 CAGTTTCAATAGTAGGTGATTGG - Intronic
1000059993 5:157646249-157646271 CAGTATCATTACTAAGTTCCAGG + Intronic
1002660061 5:180785725-180785747 CAGGATCAGGAGTAGGTGAGCGG - Intergenic
1002876346 6:1213991-1214013 AAGTATAAGTAATAGGTTAATGG + Intergenic
1003837850 6:10091291-10091313 CAGTATCAGTAGGTGGTTCTGGG - Intronic
1009466850 6:63981493-63981515 CGGTGTAAGTAGTAGTTTACAGG + Intronic
1009901609 6:69813754-69813776 CTGTCTCAGAAGGAGGTTACTGG + Intergenic
1010746427 6:79567420-79567442 AAGTTTCACTAGTATGTTACTGG + Intergenic
1011470492 6:87702770-87702792 CAGTAATAGTATCAGGTTACAGG + Intergenic
1021813580 7:24426424-24426446 CACTATCAGTAGGAGGGTAGGGG + Intergenic
1022979088 7:35586911-35586933 CTGCATCAGTAGTATGTCACAGG + Intergenic
1023472059 7:40534205-40534227 CAGAATCTGTGGTAAGTTACAGG - Intronic
1027714608 7:81654259-81654281 GAATATTAGTAGTATGTTACTGG + Intergenic
1028781239 7:94738951-94738973 CAGTATCAGTAGTAGGTTACTGG + Intergenic
1035146641 7:156824290-156824312 CAGTCTCAGCAGAAGCTTACGGG + Intronic
1043836059 8:85047851-85047873 CTTTATAAGTAGTAGGATACTGG - Intergenic
1046476712 8:114754813-114754835 CACTATCATCAGTAGGTTCCTGG - Intergenic
1051788363 9:20771634-20771656 CAGCATCATGAGTAGATTACAGG - Intronic
1057808253 9:98236584-98236606 CAGTATCAGTATCAAGCTACTGG - Intronic
1058438076 9:104982202-104982224 CAGAATCAGGAGAAGGTTAGTGG + Intergenic
1189040916 X:37542004-37542026 CAGCATCTGTAGTAGGAGACTGG + Intronic
1190928197 X:54927218-54927240 CAGTATCAGTTCTAGGACACAGG - Intronic
1198984068 X:142429142-142429164 CAGTAACAGTAGCAAGTCACAGG - Intergenic
1201757811 Y:17506036-17506058 CAGTCTCAGCAAAAGGTTACTGG - Intergenic
1201843743 Y:18399946-18399968 CAGTCTCAGCAAAAGGTTACTGG + Intergenic