ID: 1028795264

View in Genome Browser
Species Human (GRCh38)
Location 7:94895209-94895231
Sequence CTTCCAACAGAGATGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028795264_1028795268 27 Left 1028795264 7:94895209-94895231 CCTGGGTCCATCTCTGTTGGAAG No data
Right 1028795268 7:94895259-94895281 ATAAAGACAACCCCAAGACTGGG No data
1028795264_1028795267 26 Left 1028795264 7:94895209-94895231 CCTGGGTCCATCTCTGTTGGAAG No data
Right 1028795267 7:94895258-94895280 GATAAAGACAACCCCAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028795264 Original CRISPR CTTCCAACAGAGATGGACCC AGG (reversed) Intergenic
No off target data available for this crispr