ID: 1028796320

View in Genome Browser
Species Human (GRCh38)
Location 7:94907832-94907854
Sequence CCAGGCCGGCCCGAGCGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 136}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028796302_1028796320 9 Left 1028796302 7:94907800-94907822 CCAAACCCCTTCCCCGGCCGGCA 0: 1
1: 0
2: 2
3: 9
4: 221
Right 1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 136
1028796305_1028796320 2 Left 1028796305 7:94907807-94907829 CCTTCCCCGGCCGGCACCCCTGG 0: 1
1: 1
2: 2
3: 35
4: 355
Right 1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 136
1028796304_1028796320 3 Left 1028796304 7:94907806-94907828 CCCTTCCCCGGCCGGCACCCCTG 0: 1
1: 0
2: 2
3: 31
4: 289
Right 1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 136
1028796309_1028796320 -4 Left 1028796309 7:94907813-94907835 CCGGCCGGCACCCCTGGCCCCAG 0: 1
1: 1
2: 14
3: 102
4: 827
Right 1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 136
1028796299_1028796320 20 Left 1028796299 7:94907789-94907811 CCGCACGTGGGCCAAACCCCTTC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 136
1028796303_1028796320 4 Left 1028796303 7:94907805-94907827 CCCCTTCCCCGGCCGGCACCCCT 0: 1
1: 0
2: 2
3: 47
4: 367
Right 1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 136
1028796308_1028796320 -3 Left 1028796308 7:94907812-94907834 CCCGGCCGGCACCCCTGGCCCCA 0: 1
1: 0
2: 3
3: 60
4: 549
Right 1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 136
1028796311_1028796320 -8 Left 1028796311 7:94907817-94907839 CCGGCACCCCTGGCCCCAGGCCG 0: 1
1: 1
2: 8
3: 97
4: 805
Right 1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 136
1028796307_1028796320 -2 Left 1028796307 7:94907811-94907833 CCCCGGCCGGCACCCCTGGCCCC 0: 1
1: 0
2: 3
3: 50
4: 579
Right 1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028796320 Original CRISPR CCAGGCCGGCCCGAGCGTGC GGG Intronic
900519259 1:3097814-3097836 CCAGGGGGGCCCAAGCATGCAGG + Intronic
900600065 1:3499082-3499104 CCAGGCCTGAGCGAGGGTGCTGG - Intronic
900884873 1:5408011-5408033 ACAGGCCAGCCCCAGAGTGCAGG - Intergenic
901030055 1:6301895-6301917 CCAGGCCGGTGCGTGTGTGCTGG - Intronic
902044414 1:13514060-13514082 CCAGGCGGGCGCGAGGGGGCAGG - Intergenic
902404411 1:16175010-16175032 CCAGGCCTGCCCGAGGGAGGGGG + Intergenic
903190149 1:21651840-21651862 CCGGCCCGGCCCGCGCGAGCCGG + Intronic
903324783 1:22563611-22563633 CCGGGCCGGGCCGGGCGGGCGGG - Exonic
903358804 1:22764175-22764197 TCAGCCTGGCCCGAGGGTGCTGG + Intronic
906263225 1:44408249-44408271 CCGGGCCAGTCCGAGAGTGCGGG - Intronic
908132036 1:61083283-61083305 TGCAGCCGGCCCGAGCGTGCGGG - Intronic
915334955 1:155135775-155135797 GAGGGACGGCCCGAGCGTGCGGG + Intronic
916496963 1:165355553-165355575 CCGGCCCGGCCCGAACATGCTGG - Exonic
917028228 1:170664392-170664414 CGAGGCTGGCCGGAGCCTGCTGG + Exonic
919451337 1:197775599-197775621 CCCGGGCGGCCAGAGGGTGCAGG + Intronic
920504743 1:206507837-206507859 CCAGGCCGGAGCGGGCGAGCGGG - Exonic
922196491 1:223364222-223364244 CCAGGCGCCCCCGAGCGGGCGGG + Intergenic
922235200 1:223717510-223717532 CCAGGCAGTCCAGAGTGTGCAGG + Intronic
922985550 1:229863699-229863721 CCAGGGTGGCCCGAGTGTCCCGG - Intergenic
1065925983 10:30434148-30434170 GCAGGGCGGTCTGAGCGTGCGGG + Exonic
1067183153 10:44005620-44005642 CCTGGCCGGCCGGGGCATGCGGG - Intergenic
1069840137 10:71334725-71334747 CCAGGCAGGTCCGGGTGTGCAGG - Intronic
1071630262 10:87214004-87214026 CCAGGCCAGCCCGAGCCAGGAGG - Intergenic
1073186923 10:101620561-101620583 ACAGGCTGGCCAGAGCGGGCAGG + Intronic
1074772452 10:116742662-116742684 CCCGGCCGGCCCGAGCTCGGAGG - Intergenic
1083389436 11:62337317-62337339 CTTGGCCGGCCCGAGCTTCCTGG - Intergenic
1083747640 11:64744651-64744673 CCAGGGCGGCGCGGGCGGGCTGG - Intronic
1083861698 11:65423416-65423438 CCAGGCCGGGCCCAGCCTGGTGG + Intergenic
1085266693 11:75241658-75241680 CCAGGCCGGCCAGCGCGTTGAGG - Exonic
1091624208 12:2110192-2110214 CGAGGCTGGCCAGACCGTGCTGG + Intronic
1091928001 12:4371019-4371041 CCAGGCCAGCCCGGGCCTCCAGG - Intronic
1094427255 12:30328250-30328272 CCAGGCAGCCCTGAGCCTGCAGG - Intergenic
1096699350 12:53371842-53371864 CCGGGCCGGGCCGGGCGTGGTGG + Intergenic
1116887134 14:50232016-50232038 CCAGCCCGGCGCGGGGGTGCGGG + Intergenic
1119640732 14:76312924-76312946 CCAGGCAGGCTCCAGTGTGCAGG - Intronic
1122788666 14:104175394-104175416 CCAGCCCCGCCCGAGGGGGCCGG + Exonic
1122917370 14:104865324-104865346 CCGGGCTGCCACGAGCGTGCGGG + Exonic
1123063542 14:105605218-105605240 CCAGGGCGGCCCGGGCCTCCGGG - Intergenic
1125284025 15:38073056-38073078 CCAGGCCGGGCCGCGCGCCCGGG - Intergenic
1125535932 15:40441211-40441233 CCAGCCCGGCCGGGGCCTGCGGG + Exonic
1125955361 15:43787284-43787306 CCAGGCCTGGCCGGGCGTGGTGG - Intronic
1126767036 15:52019574-52019596 CCGGCCAGGCCCGAGCGGGCGGG - Intronic
1127395009 15:58537546-58537568 CCAGGCAGGCCAGAGCATGGAGG - Intronic
1128453666 15:67821329-67821351 CCAGGACGCCCCCAGGGTGCCGG - Intronic
1132289892 15:100692595-100692617 CCAGGCCAGCCCCAGCTTGCTGG - Intergenic
1132482226 16:172485-172507 CCAGGCCGGGGCGGGGGTGCGGG + Intergenic
1132483074 16:176289-176311 CCAGGCCGGGGCGGGGGTGCGGG + Intergenic
1132604646 16:788604-788626 ACTGCCCGCCCCGAGCGTGCCGG - Exonic
1132815893 16:1826453-1826475 CCGGCCCAGCCCGAGCGTGGAGG + Intronic
1132875629 16:2135723-2135745 CCAGGCCCGCCCGCGCGCGGAGG + Exonic
1133021692 16:2969683-2969705 CCTGGCCGGGCCGCGCCTGCTGG + Exonic
1134070210 16:11255924-11255946 CCAGGCCGCCCCCCGCGCGCGGG - Intronic
1134519357 16:14911630-14911652 CCAGGCCCGCCCGCGCGCGGAGG - Intronic
1134554576 16:15154598-15154620 CCAGGCCCGCCCGCGCGCGGAGG + Intergenic
1134707027 16:16310285-16310307 CCAGGCCCGCCCGCGCGCGGAGG - Intergenic
1134960513 16:18401839-18401861 CCAGGCCCGCCCGCGCGCGGAGG + Intergenic
1135534144 16:23279797-23279819 CCAGGCAGGGCCGGGCTTGCTGG + Intronic
1135992529 16:27226797-27226819 CCAGGATGGCCCGGCCGTGCAGG + Exonic
1138180969 16:54939797-54939819 CCAGGCCGGGCAGGGCGTCCCGG + Intergenic
1138360687 16:56425189-56425211 CGAGGCCGGCCCCGGCGAGCCGG - Exonic
1142187444 16:88701236-88701258 CCAGGGCGGCCCAAGCAGGCGGG + Intronic
1142249747 16:88985872-88985894 CCTGGCCGGCCCGAGAGGGTAGG + Intergenic
1142363181 16:89636784-89636806 CCAGGCCGGGCCTCGCCTGCTGG + Intronic
1142851253 17:2705920-2705942 CCAGGCAGGCCCGTGTCTGCTGG - Intronic
1143078554 17:4365694-4365716 CCACGCGGGCGCGAGGGTGCCGG - Intronic
1150124826 17:62628964-62628986 CCAGCCTGGCCCGTGCTTGCTGG + Intronic
1150249798 17:63699380-63699402 CCAGCCCGGCCCCAGCCTGCAGG + Intronic
1151686183 17:75648048-75648070 ACAGGCAGGCTAGAGCGTGCAGG - Intronic
1152924209 17:83080042-83080064 CCCGGGCCGGCCGAGCGTGCGGG + Intronic
1160854847 19:1212121-1212143 CCAGGCCTGCCCCAGCTGGCTGG - Intronic
1161327356 19:3670199-3670221 CCACGCCTGCCTGAGGGTGCGGG + Intronic
1161370418 19:3908160-3908182 CCATGCCCTCCCGAGCGTGTGGG + Intronic
1161455847 19:4369450-4369472 CCAGGCAGGACCCAGTGTGCAGG + Intronic
1161990698 19:7682430-7682452 CCAGGTGGGCGCGCGCGTGCTGG + Exonic
1162058961 19:8083205-8083227 CCAGGCTGGGCCAAGGGTGCAGG + Intronic
1162069714 19:8146388-8146410 CCAGCCCAGCCCGAGAGTGGGGG - Intronic
1163022920 19:14493129-14493151 CCAGGCTTGCCCCAGCATGCTGG + Intronic
1163370377 19:16897853-16897875 CCGGGCCGGGCCGGGGGTGCGGG + Intronic
1164732410 19:30516302-30516324 CCAGGCCGGCTGGTCCGTGCAGG - Intronic
1164783897 19:30914253-30914275 CCATGCTGGCCTGAGCGAGCAGG + Intergenic
1165158328 19:33801619-33801641 CCAGCCCAGCCTGAGCCTGCCGG + Intronic
1166714153 19:44955669-44955691 GCCGCCCGGCTCGAGCGTGCAGG - Intronic
1166807267 19:45494769-45494791 CCAGGCTGGGCTGAGGGTGCTGG + Exonic
926268076 2:11344334-11344356 CCAGCCCGGCCCGGCCCTGCCGG + Exonic
937917414 2:127106011-127106033 CCAGGGTGCCCAGAGCGTGCAGG - Intronic
937984062 2:127630701-127630723 CCAGGCCGGGAGGAGCCTGCAGG + Intronic
938251784 2:129821349-129821371 CCAGGCCGGGCTGAGCATGAGGG - Intergenic
942277418 2:174333423-174333445 CCAGGTCTGCCCGAGGGCGCTGG + Intergenic
945936127 2:215904418-215904440 CCAGGCCAGACCCAGCGTGCTGG - Intergenic
947791652 2:232872306-232872328 GCAGGCCGGGCTGAGCGGGCAGG + Intronic
948575512 2:238947124-238947146 CCAGGCCCCCCCAAGAGTGCAGG + Intergenic
1173173770 20:40748467-40748489 CCAGGCAGGCTCCAGGGTGCTGG - Intergenic
1175935355 20:62511463-62511485 CCAGGCCGGCCCAGGCCAGCAGG + Intergenic
1179821866 21:43941727-43941749 GCAGGCTGGCCCCAGCGAGCGGG + Intronic
1179926518 21:44538084-44538106 CCAGGCCGGCCGCAGCCTGATGG - Intronic
1180414292 22:12694020-12694042 CCAGGCCAGCCTGGCCGTGCCGG - Intergenic
1180876901 22:19178835-19178857 CCAGCCCGCCCCGTGCGGGCCGG + Intergenic
1180949381 22:19714393-19714415 CCAGGGCGGCCCGGGGGGGCGGG - Intergenic
1182423634 22:30260483-30260505 CCAGGGCAGGCCGAGCGTGGGGG + Intergenic
1183856078 22:40636247-40636269 CCGGGCCGGGCCGGGCGGGCGGG - Intronic
1184101460 22:42343642-42343664 CCGGGCCGGCCGGGGCGCGCGGG - Intergenic
1185227332 22:49660471-49660493 TCTGGCCGGCCCGAGGGGGCTGG + Intergenic
950669082 3:14514444-14514466 CCCGCCCGGCCCCACCGTGCTGG + Exonic
953412358 3:42697604-42697626 CCAGGCAGGCCTAAGCGTGGTGG - Exonic
954132508 3:48567726-48567748 CCAGGCCGCCCCGGGCTGGCAGG - Exonic
954150840 3:48656321-48656343 CGAGGCCGGCCGCTGCGTGCCGG - Exonic
969523622 4:7693050-7693072 CCAGCCCTGGCCGAGGGTGCCGG + Intronic
973199300 4:47481738-47481760 CCAGGCTGGCCCCAGAGTTCTGG - Intergenic
979780919 4:124650775-124650797 CCATGCCGGCCCACGAGTGCTGG - Intergenic
986661734 5:10065587-10065609 GCCGGCCGGCCCCAGCGGGCCGG + Intergenic
999272029 5:150302376-150302398 CCAAGCCGGCCCGCGCGTCCCGG + Exonic
1000929008 5:167229717-167229739 CCAGGCCAGACTGAGCTTGCAGG + Intergenic
1002175782 5:177400375-177400397 GCAGGCGGGCCTGAGCGTGGGGG - Exonic
1006131220 6:31870587-31870609 CCAGGCAGGCCCTAACTTGCTGG + Exonic
1007614321 6:43171487-43171509 CCAGGTCGGCCCGGGCGTGCAGG + Exonic
1007618493 6:43196841-43196863 CCGGGCAGCCCTGAGCGTGCAGG + Exonic
1007752078 6:44076795-44076817 CCAGGCCGGGCAGCGCCTGCAGG - Intergenic
1008535530 6:52504011-52504033 CCAGGCTGGGCAGAACGTGCAGG + Intronic
1018961935 6:168455420-168455442 CCAGGCCAGCCCGGGCTTGGTGG - Intronic
1025813236 7:64888613-64888635 CCAGGCCGCCCCGCTCCTGCTGG - Intronic
1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG + Intronic
1030884249 7:114919494-114919516 CCAGGCTGGTCCTAGAGTGCTGG + Intergenic
1034964040 7:155380735-155380757 CCAGCCTGGCCCCAGCCTGCTGG + Intergenic
1037305235 8:17497288-17497310 CCCCGCCGGCCCCAGCGTCCGGG - Intronic
1040567613 8:48581863-48581885 CCAGCCCGCCCCGAGCTGGCTGG + Intergenic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1047025084 8:120815153-120815175 CCAGGCCTGCTTGAGGGTGCAGG - Intergenic
1049258761 8:141627697-141627719 CCAGGGAGGCCGGAGCGGGCTGG - Intergenic
1049358166 8:142198941-142198963 CCAGGACGGGCCGAGAGGGCAGG - Intergenic
1049601019 8:143507711-143507733 CCAGGCCTGCAGGAGCCTGCAGG + Intronic
1049618966 8:143589280-143589302 CCAGGCCGGCTCGCTCTTGCAGG + Exonic
1049693339 8:143972291-143972313 CCAGGCCTCCCCAAGGGTGCAGG + Intronic
1050304961 9:4298170-4298192 CCAGGCCGGGCAGCGCGCGCAGG - Intronic
1051774592 9:20621012-20621034 CCAAGCCGGGCCGGGCGGGCGGG - Intronic
1057442147 9:95090607-95090629 CTAGGCCGGCCCCAGGGTGCTGG - Intergenic
1060974165 9:127754954-127754976 CCAGCCCAGCCCGACCCTGCCGG + Intronic
1061161578 9:128898587-128898609 CAAGGCCAGCCAGAGCCTGCGGG - Intronic
1061181699 9:129028310-129028332 CCGAGCCAGCCCGAGCGCGCAGG + Intergenic
1061873897 9:133534601-133534623 CCAGGCCGGCCGGCGCGGGCGGG + Intronic
1061893772 9:133636398-133636420 CCTGCCCGGCCCCAGCATGCGGG + Exonic
1062203411 9:135321270-135321292 TCAGGCAGGCCAGAGAGTGCAGG + Intergenic
1192584037 X:72306370-72306392 CCAGGCGGGCCGGAGGGTTCTGG - Intronic
1197446236 X:126554019-126554041 GCAGGCCGGCCTGAGGGTGTGGG + Intergenic
1200103296 X:153699142-153699164 CCAGGAAGGCGCGAGCCTGCAGG + Intergenic