ID: 1028809548

View in Genome Browser
Species Human (GRCh38)
Location 7:95068659-95068681
Sequence GTGGTAGACATGACTAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028809548_1028809554 16 Left 1028809548 7:95068659-95068681 CCTTCCCTAGTCATGTCTACCAC 0: 1
1: 0
2: 0
3: 16
4: 121
Right 1028809554 7:95068698-95068720 TTATGCTCTCAGCATCCCTGTGG No data
1028809548_1028809555 19 Left 1028809548 7:95068659-95068681 CCTTCCCTAGTCATGTCTACCAC 0: 1
1: 0
2: 0
3: 16
4: 121
Right 1028809555 7:95068701-95068723 TGCTCTCAGCATCCCTGTGGTGG 0: 1
1: 0
2: 1
3: 25
4: 366
1028809548_1028809557 27 Left 1028809548 7:95068659-95068681 CCTTCCCTAGTCATGTCTACCAC 0: 1
1: 0
2: 0
3: 16
4: 121
Right 1028809557 7:95068709-95068731 GCATCCCTGTGGTGGATAGTGGG No data
1028809548_1028809556 26 Left 1028809548 7:95068659-95068681 CCTTCCCTAGTCATGTCTACCAC 0: 1
1: 0
2: 0
3: 16
4: 121
Right 1028809556 7:95068708-95068730 AGCATCCCTGTGGTGGATAGTGG 0: 1
1: 1
2: 0
3: 10
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028809548 Original CRISPR GTGGTAGACATGACTAGGGA AGG (reversed) Intronic
900572808 1:3367384-3367406 ATGGCAGACGTGACTTGGGAGGG + Intronic
903548294 1:24140886-24140908 GTCGTAGACGTGTCTGGGGAAGG - Intronic
905301724 1:36990317-36990339 GTGGTAGACATGTCTATGCAGGG - Intronic
907881115 1:58549997-58550019 GTGTTAGCTTTGACTAGGGAAGG + Intergenic
907956121 1:59230050-59230072 GTGCTAGGCATGCTTAGGGAGGG - Intergenic
908057147 1:60299975-60299997 ATGGTAGAAATGAGTAGAGATGG + Intergenic
908807601 1:67947147-67947169 GTGGCAGAAATGTCTGGGGAGGG + Intergenic
910035565 1:82783611-82783633 GAGGTTGGCATGACTAGGGAAGG + Intergenic
912924337 1:113900692-113900714 TTGGGGGACATGACTAGAGAAGG + Intronic
914220591 1:145678507-145678529 GTGGTAGAAATGATTAGAAAGGG - Exonic
914473170 1:148001377-148001399 GTGGTAGAAATGATTAGAAAGGG - Intergenic
915796876 1:158744878-158744900 TTGGTAGTCATGACGAGGGAGGG - Intergenic
915934216 1:160081432-160081454 GTGGTACCCAGGACTGGGGAGGG + Intergenic
915988545 1:160490468-160490490 GTGGAAGACAGGAGGAGGGAGGG - Intronic
917481655 1:175417239-175417261 GTGGGAGACGTGACTGGAGAAGG + Intronic
922947167 1:229526532-229526554 GTGGTGTATATGATTAGGGATGG - Intronic
1064344413 10:14518223-14518245 GTGGGAGACATGTTTTGGGAAGG - Intergenic
1065817024 10:29491641-29491663 GTGGAAAACCAGACTAGGGAAGG + Intronic
1068364272 10:56025171-56025193 GTGGTAGGTAAGACTAGAGAGGG + Intergenic
1070325036 10:75383327-75383349 GTGGTAGACATCAGGAGGAATGG - Intergenic
1071280652 10:84099617-84099639 GTGGGAGACATGGTGAGGGAGGG - Intergenic
1073323205 10:102628069-102628091 CTGGCAGACAGGACAAGGGAAGG - Intronic
1073508782 10:104028370-104028392 GTTGTTGACAGGACTAGGAAAGG - Exonic
1074543247 10:114383794-114383816 GGGGGAGACATAACCAGGGAGGG + Intronic
1075565610 10:123501708-123501730 GGGGTAGACAAGACTTGGGGAGG - Intergenic
1075919278 10:126197140-126197162 GTGGAAGACATGGCTAGGTGAGG + Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1085373162 11:76030699-76030721 ATGCTAGAGATGGCTAGGGAGGG - Intronic
1085914438 11:80868305-80868327 GTGGAAGATGTGATTAGGGAAGG - Intergenic
1086784721 11:90953822-90953844 GCGGGTGACATGACAAGGGAGGG - Intergenic
1091165390 11:133471191-133471213 GAGGTTGGAATGACTAGGGATGG + Intronic
1097334926 12:58371573-58371595 GTGTTAGAAATGGCTAGGGAGGG - Intergenic
1099141485 12:78981920-78981942 GTGGCATCCATGCCTAGGGATGG + Intronic
1103838094 12:123840138-123840160 CTGGTTGTCATAACTAGGGAGGG - Intronic
1106932895 13:34686106-34686128 TTGGAAGACATGACTTGAGATGG - Intergenic
1108398568 13:50015028-50015050 GTGGTAGACAGGTATGGGGAGGG + Intronic
1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG + Intergenic
1111921820 13:94420418-94420440 GTGATAAACATAACAAGGGAAGG + Intergenic
1112002900 13:95228318-95228340 GCGGCAGACATGACTTGGGAAGG + Intronic
1114536357 14:23425434-23425456 GTGTTGGCCATGACTAGGGAGGG + Intronic
1120481064 14:85049957-85049979 GTGGTAGCCCTGACTAAGCAAGG + Intergenic
1121891790 14:97601385-97601407 GTGGGAAACACGACGAGGGAAGG + Intergenic
1126001199 15:44211535-44211557 GTGGTACACATCAGAAGGGAGGG - Intergenic
1127110395 15:55663491-55663513 GTGATTGCCATGACTAGAGATGG - Intronic
1130663089 15:85846267-85846289 GTGGTAGAAAGGACTAGGCGAGG + Intergenic
1133850578 16:9499599-9499621 TTGGTTGACATGACTGGGGGTGG + Intergenic
1134216168 16:12318462-12318484 GAGGGAGGCATGACTTGGGAGGG + Intronic
1139235901 16:65338709-65338731 GTGGCAGACATGACTAAGCCTGG - Intergenic
1140137854 16:72223709-72223731 CTAGTAGACATGACAAAGGAGGG + Intergenic
1141225661 16:82112656-82112678 GTGGTTGATATGACTATGAAAGG - Intergenic
1141645964 16:85367796-85367818 CTGGGAGACATGACCAGGGGAGG + Intergenic
1149220998 17:54415148-54415170 GTGCTACAGATGACTAGGTAGGG - Intergenic
1151168093 17:72222005-72222027 GAAGTAGAAATGACTAGAGAAGG - Intergenic
1153582919 18:6593652-6593674 GAGGTACACATGACTGGGGGAGG - Intergenic
1156028071 18:32679572-32679594 GTCGTATACATATCTAGGGAAGG + Intronic
1156233847 18:35182404-35182426 TTGGTGGACTGGACTAGGGATGG - Intergenic
1156389027 18:36633417-36633439 TAGGCAGATATGACTAGGGAAGG - Intronic
1162918897 19:13888957-13888979 GTTGTCGACATATCTAGGGATGG - Intronic
1165407441 19:35639323-35639345 GGGGTAGAAAAGACTAGTGATGG - Intergenic
1165761796 19:38325970-38325992 GTGGTGGACAGGACCAGGGTGGG + Intronic
1166348038 19:42179080-42179102 CTGGTAGACAAGGCTGGGGATGG + Intronic
1166397142 19:42449763-42449785 GTGCTAGAGATGACTAAGTAGGG + Intergenic
1166636051 19:44452694-44452716 ATGGGAGACATGATTAAGGAGGG + Intergenic
1167646049 19:50705636-50705658 TTGGTTGTCATGACTGGGGAGGG - Intronic
934141802 2:89054139-89054161 GTGCTATAGATGACTAGGTAGGG - Intergenic
937422706 2:121771741-121771763 GTGATAGGCATGACTGGGTAAGG + Intergenic
942513877 2:176730997-176731019 GTTGGAGATTTGACTAGGGATGG - Intergenic
944505912 2:200410556-200410578 GAGTTGGACATGATTAGGGAGGG - Intronic
946483581 2:220079349-220079371 GTGGTAGGCATGGGGAGGGAGGG + Intergenic
1168894034 20:1311612-1311634 GTGCTAGACAGGACTAGTGATGG + Intronic
1169040949 20:2494897-2494919 GTGGTAGACATGCATAGCAATGG - Intronic
1173688303 20:44939369-44939391 ACGGTAGACATGACTGGGGTGGG + Intronic
1174213880 20:48901119-48901141 TTGGTTGTCATGACTGGGGATGG - Intergenic
1174896707 20:54457173-54457195 GTGGTTGTCATTACTATGGAGGG - Intergenic
1175105698 20:56613271-56613293 TTGGTTGTCATGACTAGGGAGGG - Intergenic
1181029080 22:20141346-20141368 GGGGCAGCCACGACTAGGGAGGG + Intronic
1182771606 22:32800913-32800935 GGGTTGGACATGACTGGGGAGGG - Intronic
1184100740 22:42340771-42340793 GTGGAAGAGATGATGAGGGATGG - Intronic
953947431 3:47162054-47162076 TTGGTAGACCTGAGTGGGGAAGG - Intronic
956406530 3:68933381-68933403 GTGGAGGGCATGACTAGGAATGG - Intergenic
957790742 3:84937646-84937668 GAGGTAATCATGACTAGGGGAGG + Intergenic
958762485 3:98326058-98326080 GTTGTAGACATAAAGAGGGAAGG - Intergenic
959638317 3:108601583-108601605 GTGCTAGAGTTGACAAGGGAGGG + Intronic
960554873 3:119016766-119016788 CTGGTACACAAGACTGGGGAGGG - Intronic
961313964 3:126021697-126021719 GTGTTAGACATGAGCAGGGCAGG - Intronic
962162976 3:133019233-133019255 CTGGTAGAAAGAACTAGGGAAGG + Intergenic
965496166 3:169401601-169401623 AGGGTAGAAATGGCTAGGGAAGG + Intronic
966024152 3:175255061-175255083 CTGGCAGACATGTCTAGTGAGGG + Intronic
970937674 4:21593607-21593629 GTGGGAGAGATGACTTGGCATGG - Intronic
971149189 4:24013076-24013098 GTGCTAAACACAACTAGGGAGGG - Intergenic
971166518 4:24189563-24189585 GTAGTAGAGGTGATTAGGGAAGG - Intergenic
971665682 4:29480654-29480676 TTGGTTGTCATGACTTGGGATGG + Intergenic
972635890 4:40883674-40883696 GTAGAAGACATGGCTAGGAAGGG + Intronic
981488883 4:145318730-145318752 GCGGTAAACATGACTTGGCATGG - Intergenic
989217274 5:38918276-38918298 GTGGTACACATGCCAGGGGAGGG + Intronic
992825924 5:80550183-80550205 GTGGTAGACATTACAAGAGGAGG - Intergenic
995894631 5:116998039-116998061 GTAGCAGACATGGCCAGGGACGG + Intergenic
996870933 5:128192691-128192713 TTGGCAGAAAAGACTAGGGAAGG + Intergenic
997185503 5:131877783-131877805 GTGGTAGACAAAACTGTGGATGG - Intronic
998090501 5:139364507-139364529 TTGGTAGATATCACTAGGAATGG - Intronic
1001215257 5:169850076-169850098 GTGGAAGACAAGACTGGGGGTGG + Intronic
1001233524 5:170010200-170010222 TTGGTTGTCATAACTAGGGAGGG - Intronic
1001945875 5:175777548-175777570 GTGGTAGATGAGGCTAGGGAAGG + Intergenic
1005786056 6:29247121-29247143 GTGCTATAGATGACTAGGTAGGG + Intergenic
1005817925 6:29571863-29571885 GTAGTAGGTATGATTAGGGAAGG + Intronic
1006312205 6:33268731-33268753 GTGGTAGAGATGACAGGGGCTGG - Intronic
1006383515 6:33715415-33715437 GTGGTAGACAAGACAGGTGAGGG + Intergenic
1007044085 6:38754310-38754332 TTTGTAGACATGACTTAGGAAGG + Intronic
1013622287 6:111901521-111901543 GAGGTAGAAAGGACCAGGGAGGG - Intergenic
1015583362 6:134750550-134750572 ATGGTAGATATGAACAGGGAAGG + Intergenic
1015992124 6:138956370-138956392 ATGCTAGGTATGACTAGGGATGG + Intronic
1018016631 6:159718286-159718308 GTGGTATATATGACCAGGCATGG - Intronic
1020569519 7:9841522-9841544 CATGTAGACATGACTAGGTATGG - Intergenic
1022717761 7:32914276-32914298 CTGGTAGACATGATTAGTCAAGG + Intergenic
1023615542 7:42016004-42016026 TTGGTTGTCATGACGAGGGAGGG + Intronic
1026012252 7:66645643-66645665 ACTGTAGACATGACTGGGGAAGG - Intronic
1028809548 7:95068659-95068681 GTGGTAGACATGACTAGGGAAGG - Intronic
1030194031 7:106835698-106835720 GTGCTATAGATGACTAGGTAGGG - Intergenic
1031999226 7:128254020-128254042 GGGGTAGAAGGGACTAGGGAAGG + Intronic
1043721300 8:83548978-83549000 GTGCTATAGATGACTAGGTAGGG - Intergenic
1044615698 8:94138161-94138183 TTGGCAGATATGAATAGGGAGGG - Intronic
1045431578 8:102119751-102119773 GTGCAAGACATAATTAGGGAAGG - Intronic
1045762622 8:105628583-105628605 CTGGTAGACAGGACTACGGCTGG + Intronic
1046290816 8:112158098-112158120 GTGGTAGACATGACTTAAGAAGG + Intergenic
1047966867 8:130051406-130051428 TTGGTAGACATGGCTGGGCACGG - Intergenic
1048187752 8:132259051-132259073 TTGGTAGAAATCACTAGTGAAGG - Intronic
1048940437 8:139396005-139396027 GTGGTAGAAATGAAGAGGGAAGG - Intergenic
1050455366 9:5829800-5829822 GTGGTAGACAAGACCTGAGATGG - Intronic
1050895671 9:10883882-10883904 TTTGTAGACATGAGTAGGGTCGG + Intergenic
1051770898 9:20578252-20578274 GTGCCAGATATGACTAGGGAAGG - Intronic
1053017023 9:34667672-34667694 GGGGCAGACAGGACTGGGGAGGG + Intergenic
1061748089 9:132754676-132754698 GTGATAGGCATGGCTAGGGGAGG - Intronic
1185650708 X:1645967-1645989 GTGGTAGACATGGCTATGGTGGG + Intergenic
1190788907 X:53681810-53681832 GTGGAAGAAATGAGTAGGCAGGG + Intronic
1191721461 X:64231960-64231982 GAGGTAGACAAGACTGGGGAGGG - Intergenic
1197032646 X:121836208-121836230 GTGGGAAACAAGACTAGGGAGGG + Intergenic
1198425852 X:136519531-136519553 GTGGTAGGGAAGACTGGGGAAGG + Intergenic
1199758414 X:150886695-150886717 TTGGTTGACAAGACTAGGGAGGG + Intronic