ID: 1028820216

View in Genome Browser
Species Human (GRCh38)
Location 7:95200701-95200723
Sequence TCTGATTACTTTACAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028820216_1028820217 4 Left 1028820216 7:95200701-95200723 CCTGTTTTTGTAAAGTAATCAGA 0: 1
1: 0
2: 0
3: 19
4: 260
Right 1028820217 7:95200728-95200750 TCACCTGAGCAGATATTTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 157
1028820216_1028820219 6 Left 1028820216 7:95200701-95200723 CCTGTTTTTGTAAAGTAATCAGA 0: 1
1: 0
2: 0
3: 19
4: 260
Right 1028820219 7:95200730-95200752 ACCTGAGCAGATATTTTCAGGGG No data
1028820216_1028820218 5 Left 1028820216 7:95200701-95200723 CCTGTTTTTGTAAAGTAATCAGA 0: 1
1: 0
2: 0
3: 19
4: 260
Right 1028820218 7:95200729-95200751 CACCTGAGCAGATATTTTCAGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1028820216_1028820221 11 Left 1028820216 7:95200701-95200723 CCTGTTTTTGTAAAGTAATCAGA 0: 1
1: 0
2: 0
3: 19
4: 260
Right 1028820221 7:95200735-95200757 AGCAGATATTTTCAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028820216 Original CRISPR TCTGATTACTTTACAAAAAC AGG (reversed) Intronic
902974117 1:20076475-20076497 TCTGTGTTCTTTACAAAAAAGGG - Intronic
902982190 1:20132477-20132499 TCTGATGGCTTTAAAAAAACGGG - Intergenic
904158840 1:28507178-28507200 TCTAATTACTTTACAATAGGCGG - Intronic
904654922 1:32037755-32037777 TCTGATTTGTTTACAAATTCTGG - Intronic
908282234 1:62552649-62552671 TCAGAATACATTACAACAACTGG + Intronic
909017860 1:70399042-70399064 TGTTATTATTTTATAAAAACAGG - Intergenic
909207626 1:72779394-72779416 TTTGCTTATTTTCCAAAAACTGG - Intergenic
909716634 1:78715831-78715853 TTTGCTTACATCACAAAAACTGG + Intergenic
911210957 1:95137510-95137532 TGTGATTCCTTTGCAAATACAGG - Intronic
913690976 1:121279510-121279532 ACTGATCATTTAACAAAAACAGG - Intronic
914146563 1:145000453-145000475 ACTGATCATTTAACAAAAACAGG + Intronic
916874222 1:168951652-168951674 CCTGATTAATTAACAAAAAATGG + Intergenic
917593123 1:176497975-176497997 ACTTATTACCTTACAAAAAGAGG - Intronic
917982193 1:180276892-180276914 TATGATTAACTTACAAAAACTGG - Exonic
918132331 1:181640422-181640444 TCCTATTCCTTAACAAAAACAGG - Intronic
918758588 1:188371305-188371327 TCTGCTTTCTTCACAAAGACTGG + Intergenic
919738327 1:200967619-200967641 TCTGCTTACTTTAGAAAATTTGG - Intergenic
920478299 1:206297985-206298007 ACTGATCATTTAACAAAAACAGG - Intronic
920586822 1:207172577-207172599 TTTGTTTACCTTACAATAACTGG + Intergenic
924405905 1:243745468-243745490 CCTCCTTATTTTACAAAAACAGG + Intronic
924841793 1:247718610-247718632 GCTGAGTACTTTGGAAAAACTGG + Intergenic
1064885549 10:20107960-20107982 TCTGAATCATTTACAAAACCTGG - Intronic
1065417363 10:25502860-25502882 GCTGGTTCCTTTACAAAAAAAGG + Intronic
1068934140 10:62619603-62619625 CCTGAGTACTTTAGAAGAACTGG - Intronic
1070232002 10:74578248-74578270 TCTCATTATTTTACATAAGCAGG + Intronic
1071919753 10:90336226-90336248 GCTTATAACTTTAGAAAAACAGG + Intergenic
1072221301 10:93329874-93329896 TCTGAGTACCTCACAAAAACTGG + Intronic
1074668605 10:115760810-115760832 TCTGATTACTTTTAAATTACTGG - Intronic
1077771636 11:5225423-5225445 TCTGAATATTTTACTAAAAAGGG - Intergenic
1079181809 11:18200656-18200678 TCTGATGGCTTTAAAAAAATGGG - Intronic
1079295257 11:19227521-19227543 TCTAATTATTTTATAAAAAAGGG - Intronic
1079450959 11:20599367-20599389 TCTGATTACTAAACCGAAACCGG - Intergenic
1081331910 11:41812123-41812145 TCTGATAACTTTAAAATAAATGG - Intergenic
1081495745 11:43608524-43608546 TTTGTTTGTTTTACAAAAACAGG + Intronic
1081826899 11:46063503-46063525 TCTAATAATTTTACAAAAACAGG + Intronic
1083789935 11:64977976-64977998 TCTGGTTACTTTGGAAAAAGGGG - Intergenic
1084414629 11:69024331-69024353 ACTCATTACTTAACAGAAACAGG - Intergenic
1087689689 11:101306037-101306059 TAGTATTACTTTACCAAAACAGG + Intergenic
1088582897 11:111332319-111332341 TCTCAGTACTTTGTAAAAACTGG - Intergenic
1089794018 11:120966060-120966082 TTAGATTTCATTACAAAAACAGG - Intronic
1094045744 12:26164747-26164769 TTTAATTGTTTTACAAAAACAGG - Intronic
1094145057 12:27219953-27219975 TCAGATTAGTTTAAATAAACAGG - Intergenic
1095390772 12:41703785-41703807 TCTAATTACATTAAAGAAACAGG + Intergenic
1095865300 12:46965143-46965165 TCTGATTACTTTTAGAGAACAGG - Intergenic
1098495733 12:71133535-71133557 TCTGATCACTTTTGAAAGACAGG + Intronic
1099048855 12:77758763-77758785 TCTCATTTATTTCCAAAAACAGG - Intergenic
1099095034 12:78364668-78364690 ACTTATTACTTTGCAAAAAAGGG - Intergenic
1099294517 12:80813398-80813420 GCTAATAACTTAACAAAAACTGG + Intronic
1102482733 12:113234828-113234850 TCTAATTTCTTTTGAAAAACTGG - Intronic
1102646430 12:114406754-114406776 TTTGATTATTTTAATAAAACTGG - Intronic
1104291850 12:127476741-127476763 TCAGAATAATTTACTAAAACAGG + Intergenic
1105321051 13:19322849-19322871 GCTGGTTAATTTACAAAAAAAGG + Intergenic
1107024894 13:35790619-35790641 TTTGATAGATTTACAAAAACTGG - Intronic
1107893880 13:44938983-44939005 TCTGATTACATCACAAAAAGAGG + Intergenic
1108755921 13:53502310-53502332 TGTGATTAGCTTACAAACACAGG + Intergenic
1110462826 13:75764750-75764772 TCTGAAGACTTGCCAAAAACTGG - Intronic
1110577149 13:77070630-77070652 GCTGACTAACTTACAAAAACAGG - Exonic
1111359182 13:87151884-87151906 TCTAAGTATTTTAAAAAAACAGG + Intergenic
1111786789 13:92797246-92797268 TATGATTATTTTTTAAAAACAGG - Intronic
1112579395 13:100665398-100665420 TCTGATTAATTTAAACAAAAAGG + Intronic
1112833911 13:103490285-103490307 TCTGAGTACTTTACATAATTAGG - Intergenic
1115256761 14:31411205-31411227 TCTTATGAATTTTCAAAAACTGG - Intronic
1116944194 14:50820733-50820755 TGTGACTTCTTTGCAAAAACTGG - Intronic
1117788556 14:59313803-59313825 TCTGATGAGTTTTTAAAAACAGG - Intronic
1117959093 14:61145554-61145576 TCAGATTACTTTAAAGAAATGGG + Intergenic
1119012093 14:71004082-71004104 TTTTATTTATTTACAAAAACAGG - Intronic
1119739842 14:77007265-77007287 TCTGAGTACTTTACAGATGCAGG - Intergenic
1120061927 14:79993510-79993532 TCTGACTATTTTAGTAAAACTGG + Intergenic
1123103690 14:105825110-105825132 ACTGCTTACTTTAAAAAAAGAGG - Intergenic
1124529398 15:30491213-30491235 TCTGATTGTTTTATAAATACAGG + Intergenic
1124769257 15:32516477-32516499 TCTGATTGTTTTATAAATACAGG - Intergenic
1124901807 15:33830586-33830608 TCTGAGTACATTACATATACAGG - Intronic
1128603024 15:69013833-69013855 TCTGGTTAATTTCCAAAATCAGG - Intronic
1136853232 16:33631051-33631073 TGTGATTTCTTTAAAAAACCAGG - Intergenic
1138224840 16:55284076-55284098 ACTGATTTCCTTCCAAAAACAGG + Intergenic
1138767388 16:59620654-59620676 TCTGATCAGTTTTCTAAAACAGG + Intergenic
1138774173 16:59701146-59701168 TCTGAATACTTTATAAAAGCTGG + Intergenic
1140733685 16:77878923-77878945 TCTTATTACTTTGCAAAATTTGG - Intronic
1141357229 16:83358716-83358738 TCTGATTACCATAGGAAAACTGG - Intronic
1203114829 16_KI270728v1_random:1479493-1479515 TGTGATTTCTTTAAAAAACCAGG - Intergenic
1151092680 17:71460828-71460850 TTTGATTAGTTGACAAATACTGG + Intergenic
1152533836 17:80938816-80938838 TCTGATTACAAAACAGAAACAGG - Intronic
1154243366 18:12673042-12673064 TCAGTTTTCTTTACACAAACAGG - Exonic
1155194886 18:23464670-23464692 TTTGAATACCTTTCAAAAACAGG + Intronic
1155283680 18:24266991-24267013 TTTGATTACTTTTCAAAGAACGG - Intronic
1155883319 18:31177498-31177520 TCTGATGGTTTTAAAAAAACGGG + Intergenic
1156926029 18:42580542-42580564 TCAGATTAGTTGACCAAAACAGG + Intergenic
1157022228 18:43798515-43798537 AATGATTAATTTACAAACACTGG - Intergenic
1157077009 18:44477338-44477360 TCTCATCTCTTTACACAAACTGG + Intergenic
1158061324 18:53347303-53347325 TCTGAGTATTTTACAAAACTAGG - Intronic
1158111014 18:53941669-53941691 TCAGATTACTTTAAACAAAAAGG + Intergenic
1158169647 18:54583110-54583132 TCTGCTTACATTACCTAAACCGG - Intergenic
1158451567 18:57570712-57570734 TCTTAGTATTATACAAAAACAGG + Intronic
1158540832 18:58352733-58352755 ACTGATCATTTTACTAAAACAGG + Intronic
1158673014 18:59493898-59493920 TCTGATGATTTTTTAAAAACAGG + Intronic
1159913730 18:74170428-74170450 TCTGAGTAATTTATAAAAAGGGG + Intergenic
1159944247 18:74432046-74432068 TCTCATATCCTTACAAAAACTGG - Intergenic
1159990379 18:74899828-74899850 TCTCACTACTGTACTAAAACGGG - Intronic
1160657885 19:282612-282634 ACTGATTTGTTTATAAAAACGGG - Intronic
1162397503 19:10425578-10425600 TCTTATGACTTTAGGAAAACTGG + Intronic
1164337278 19:24339663-24339685 TCTGCAGATTTTACAAAAACAGG - Intergenic
925446635 2:3931691-3931713 TATGGTAACTTGACAAAAACAGG + Intergenic
925583363 2:5437397-5437419 TCTAATTTCTTTATAAAACCAGG - Intergenic
926665573 2:15518860-15518882 TCTGATGATTTTAAAAAAATGGG - Intronic
926994206 2:18716333-18716355 TCTGAAGAATTTACAATAACAGG - Intergenic
931106428 2:59061573-59061595 TTGGAATACTTTACTAAAACTGG - Intergenic
931595224 2:63934654-63934676 TTTTATTTTTTTACAAAAACTGG - Intronic
932115057 2:69038586-69038608 TCTTATTTCTTTAAAAAAATGGG - Intronic
932460234 2:71877414-71877436 ACTGATAGCTTTATAAAAACAGG + Intergenic
936860654 2:117014655-117014677 TTTGAGAACTGTACAAAAACAGG + Intergenic
939141145 2:138356107-138356129 TCTCATTGCTTGGCAAAAACTGG - Intergenic
941940314 2:171029714-171029736 ACTGATTACTTTTCAAAGTCAGG - Intronic
943063560 2:183063370-183063392 TATTATTATTTTACAAAAAGAGG - Intergenic
943542556 2:189235648-189235670 ATGGATTACTTTACAAAAAATGG - Intergenic
943565206 2:189508833-189508855 TCTGATGGCTTTAAAAAAATGGG + Intergenic
1171174904 20:23044409-23044431 TCTGTTTACTTTAAAACAGCAGG + Intergenic
1171302389 20:24075010-24075032 TCTGAGAACTTCACAAAAACAGG - Intergenic
1171462374 20:25305667-25305689 TTTGATTTCTTTAAAAAAAGAGG - Intronic
1171574534 20:26292019-26292041 TCTGATATCTTCACAAAAACTGG + Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1172920947 20:38481493-38481515 TCTGATGGCTTTTTAAAAACCGG - Intronic
1173129289 20:40373228-40373250 TCTGATCACTGTATAAAATCTGG + Intergenic
1173427209 20:42953685-42953707 TCTGCTGCCTTTACATAAACGGG - Intronic
1173483874 20:43426023-43426045 TGTGATTGTTTTACAAAAATAGG - Intergenic
1174073418 20:47914845-47914867 CATGATTACTCTACAGAAACAGG + Intergenic
1176951802 21:15056414-15056436 TCTGATTCCTTTCCAATATCTGG - Intronic
1177168426 21:17628809-17628831 CCTGATTACTTTCTAAGAACTGG - Intergenic
1177257463 21:18684000-18684022 TCTGTTTGCCTTACAAAAATAGG + Intergenic
1177886472 21:26751803-26751825 TCTTAGTATTTGACAAAAACTGG + Intergenic
1179311943 21:40204111-40204133 TCTGCTTACTTTCCAAGAATAGG + Intronic
1179424422 21:41263147-41263169 ACTGAATACTTTTCAGAAACTGG - Intronic
1180707722 22:17819334-17819356 TCTGCTTAGTTTAGACAAACTGG + Intronic
1184260950 22:43315774-43315796 ACTGATTAATTTAAAAGAACTGG - Intronic
949648537 3:6127657-6127679 ACTGATGACTTTAAACAAACAGG - Intergenic
949662657 3:6297888-6297910 ACTGATTAATTTAAAAAAATGGG - Intergenic
951854800 3:27183620-27183642 TGTCATTAATTTAAAAAAACAGG + Intronic
952152736 3:30610068-30610090 TCTGATATCATTGCAAAAACTGG + Intronic
953126986 3:40100526-40100548 ATTGACTGCTTTACAAAAACAGG + Intronic
953362777 3:42313293-42313315 TCTGATTACTTGGGAAAACCGGG - Intergenic
955601030 3:60645232-60645254 TCTCATGCCTTGACAAAAACTGG + Intronic
956574454 3:70736458-70736480 TTTGATTGCTTTAAAAAAATAGG - Intergenic
957158192 3:76573247-76573269 TCAGTTTCCTCTACAAAAACTGG + Intronic
957513804 3:81224661-81224683 CATGATTTCTTTATAAAAACTGG + Intergenic
958590313 3:96149816-96149838 TATGATTACTTCATAAATACTGG + Intergenic
959001228 3:100966415-100966437 TCTGCTGTTTTTACAAAAACAGG - Intronic
959417105 3:106088720-106088742 TATGTTCATTTTACAAAAACTGG + Intergenic
959999847 3:112719718-112719740 TAACATTACTTTAGAAAAACAGG + Intergenic
961942091 3:130648617-130648639 TCTGATAATTTTAGAAAAATTGG - Intronic
962553097 3:136515627-136515649 CCTTGTTTCTTTACAAAAACTGG + Intronic
963224673 3:142850192-142850214 TCTGATTATTGTACAAATAGAGG - Intronic
964314440 3:155428546-155428568 TCTGATTCCTAAACAAAAAGGGG - Intronic
965121756 3:164568300-164568322 TCTCATTATTTTAGGAAAACAGG - Intergenic
965141862 3:164848309-164848331 TATCATTACTTTACTAAAACAGG - Intergenic
965233167 3:166079605-166079627 TCTGAATACTTTCCATAAAAAGG + Intergenic
965849626 3:173008561-173008583 TTTGATCACTCTGCAAAAACTGG + Intronic
966709924 3:182961093-182961115 TCTAATTACTTTTCAATAACTGG + Intronic
967645080 3:191912936-191912958 TCTTTTTACTTTGCAACAACGGG + Intergenic
968181030 3:196595420-196595442 ACTAAGTACTTTACAAACACTGG - Intergenic
968198156 3:196727710-196727732 TCTGCTTACTAAAAAAAAACTGG - Intronic
969550717 4:7865084-7865106 TCAGATTGTGTTACAAAAACTGG + Intronic
970537758 4:17046723-17046745 TCTGCTTACTTCAGAAATACTGG + Intergenic
971601635 4:28598865-28598887 TTTGATTACTTTGCAGAAATGGG - Intergenic
974729947 4:65850074-65850096 TCTGATTGCTTTCCAAACCCAGG - Intergenic
974920930 4:68238057-68238079 GCTAATTACTTAACCAAAACAGG - Intronic
976609455 4:87014793-87014815 TCTGGTTACTTTAAAAATACAGG + Intronic
978152503 4:105453891-105453913 TTTGCTTACTTTATAAAAACTGG - Intronic
978172110 4:105685380-105685402 TCTAATTACTTTCAATAAACTGG + Intronic
980962902 4:139493860-139493882 TCTGATTACTTTGTGAAAAGTGG + Intergenic
982371717 4:154640542-154640564 TCTTGTTACTTTATAAAATCTGG + Intronic
982532766 4:156567451-156567473 TCTGAATAATTTAAATAAACAGG - Intergenic
983355399 4:166650275-166650297 TCTGCTTACATTATAATAACAGG - Intergenic
984511054 4:180679240-180679262 TCTACTTCCTTTACAATAACTGG + Intergenic
984748107 4:183243243-183243265 TCTGAAGACTTTACACAAACAGG + Intronic
985034693 4:185826577-185826599 TATGATTACCTTGCAAAATCAGG + Intronic
985120569 4:186636914-186636936 TCTGTTAACTTTAAAAAAACAGG - Exonic
985175585 4:187196309-187196331 TCTGCATACTTTACACAAATGGG - Intergenic
986123309 5:4863289-4863311 TCTGGTGTCTTTACAAAAAGCGG + Intergenic
986250787 5:6056757-6056779 TTTGATTGCTTCACAAAAGCAGG - Intergenic
987000215 5:13652330-13652352 TCTGATGGTTTTAAAAAAACAGG + Intergenic
987267151 5:16267685-16267707 TCTGATTGGTTTATAAAAATAGG + Intergenic
987479416 5:18433796-18433818 TCTGATTGTTTAAAAAAAACAGG - Intergenic
987735325 5:21834024-21834046 TTTGCTTATTTTTCAAAAACAGG + Intronic
989213837 5:38883444-38883466 TCTTAGTACCTTACAACAACAGG - Intronic
991134871 5:63169852-63169874 TGTGTTTACTTTACTAAAATGGG + Intergenic
991155017 5:63423911-63423933 TTTAATTATTTTTCAAAAACTGG - Intergenic
991252406 5:64578227-64578249 TCTGATTATTTTTTAAAAATAGG - Intronic
992458623 5:76939848-76939870 TCTGACTCCTTTAAAAAATCAGG + Intergenic
992932585 5:81664695-81664717 TCTAATTTCTATACACAAACAGG + Intronic
992974249 5:82096853-82096875 TCAGATGATTTTACAAAAAAAGG - Intronic
993539315 5:89128938-89128960 TATGATTACTTTATACAAAATGG - Intergenic
993957886 5:94259021-94259043 TCTGCATACTTTACTAAAAGGGG - Intronic
994062252 5:95492230-95492252 TCTGATTACTATATAAAGAAAGG + Intronic
994243687 5:97453781-97453803 TTTTATTACTTTACAAGTACAGG - Intergenic
995067735 5:107880858-107880880 TCAGATTAGTTTACAAAAGCAGG + Intronic
995880092 5:116835190-116835212 TCTGATGACTTAATAAAAATAGG + Intergenic
996037879 5:118778957-118778979 TCTGATAAGTTTTCAAAAAGTGG - Intergenic
996516846 5:124379903-124379925 TCTAAATATTTTACAATAACAGG - Intergenic
996689648 5:126326327-126326349 TGTGTTTTCTTTACAAAGACGGG - Intergenic
997033160 5:130155334-130155356 CCTGATTACTGCACAAAAAGAGG - Intronic
997814123 5:136999610-136999632 TCTGAGGATTTGACAAAAACGGG + Intronic
997945320 5:138195158-138195180 GCTGCTTGCTTTACAAAAATAGG - Intronic
998576094 5:143318273-143318295 TCTGATTACTACACCAAAATTGG + Intronic
999865890 5:155699977-155699999 TATGACCACTTTACAGAAACAGG + Intergenic
1000682100 5:164197779-164197801 TCTTTTTATTTTACATAAACTGG + Intergenic
1000740793 5:164968133-164968155 TGTCATTGCTCTACAAAAACAGG + Intergenic
1001759831 5:174198265-174198287 ACTGATTTCTTTAGAAAGACTGG - Intronic
1001974688 5:175987820-175987842 CCTGATTTCTTTTCAAAACCCGG + Intronic
1002242746 5:177855959-177855981 CCTGATTTCTTTTCAAAACCCGG - Intergenic
1002491375 5:179580177-179580199 TTTGATTTGTTTACAAAAACGGG - Intronic
1004347877 6:14865307-14865329 TCTCATTTTTTTAAAAAAACGGG - Intergenic
1006561574 6:34917515-34917537 ACAGATTATCTTACAAAAACTGG - Intronic
1008835847 6:55828190-55828212 TGTGGTTACATGACAAAAACAGG + Intronic
1011059714 6:83250970-83250992 TGCAATAACTTTACAAAAACAGG + Intronic
1011648277 6:89481592-89481614 TCTGTTGACTTTAGAAAAAGAGG + Intronic
1012104988 6:95145905-95145927 TCTGGTTACTTCAAAAAAAAAGG + Intergenic
1012868366 6:104644655-104644677 TCTGATTTCTCTTGAAAAACTGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1014714926 6:124852630-124852652 TAAAATTAATTTACAAAAACAGG + Intergenic
1015108681 6:129567445-129567467 CCTTATCACTTTACCAAAACTGG + Intergenic
1015718883 6:136219977-136219999 TTTGTTTACTTTACAAAATAAGG + Intergenic
1016191201 6:141267357-141267379 TCAGATTGCTTTCCAAAATCAGG - Intergenic
1016375457 6:143416229-143416251 TCTTGGTCCTTTACAAAAACTGG - Intergenic
1016862159 6:148731503-148731525 TCTGATGGATTTAAAAAAACGGG + Intergenic
1017128538 6:151088772-151088794 TCTGATTCTTTCACAAAACCAGG - Intronic
1017610635 6:156182758-156182780 TCTGATCACTATACAAACAATGG - Intergenic
1017856216 6:158351425-158351447 TTTGATTAATTTGCAAAAACGGG - Intronic
1018158883 6:161017679-161017701 TATGTTTACTTTACATAAAAAGG - Intronic
1019119389 6:169791141-169791163 TTTGATTACTTTAAAATAAGAGG + Intergenic
1021411786 7:20337233-20337255 TGTAATTAGATTACAAAAACTGG + Intronic
1021640217 7:22729187-22729209 TCTGATTATTTTATAAAAGGAGG + Intronic
1022548509 7:31212191-31212213 TCTGATTTTTTTTCAAAAATTGG - Intergenic
1023916673 7:44595045-44595067 TTTGATTAATTTACATGAACTGG + Intergenic
1024176827 7:46848830-46848852 TCTGATAACTTTACATAGAAGGG + Intergenic
1024616575 7:51119452-51119474 TCCTTTTACTTTACAAACACAGG - Intronic
1024922313 7:54572302-54572324 TATTTTTACTTTAAAAAAACAGG - Intergenic
1027520107 7:79196339-79196361 TTTGATTGCTTTTCAAAAAGTGG - Intronic
1027901979 7:84128093-84128115 ACAGTTTACTTTACAAAAAATGG + Intronic
1028514010 7:91656599-91656621 TCTGATTATTTTCCCAAAACTGG + Intergenic
1028820216 7:95200701-95200723 TCTGATTACTTTACAAAAACAGG - Intronic
1029143783 7:98431097-98431119 TCTGTTTACTGTGCAACAACAGG - Intergenic
1030841178 7:114356223-114356245 TCAGTTTGCTTAACAAAAACTGG - Intronic
1031562924 7:123260255-123260277 TTGGATTACTGTAGAAAAACAGG + Intergenic
1031645758 7:124222854-124222876 TCTGATGGTTTTAAAAAAACAGG + Intergenic
1031904378 7:127444974-127444996 AGTGAGTACTTTAAAAAAACAGG - Intergenic
1033178536 7:139150747-139150769 CCTGTTTACTTTAGAAAAGCAGG - Intronic
1034862338 7:154609017-154609039 TGTGATGACCTTACAGAAACAGG - Intronic
1035963250 8:4160340-4160362 CTTCATTACTTTACAAAAAATGG - Intronic
1038008355 8:23453469-23453491 TCTTATTTCTTTATAATAACTGG - Intronic
1040833190 8:51701735-51701757 TCTGATTGCTTTTCAATAAAGGG + Intronic
1040834084 8:51713536-51713558 TCAGATTACTTGAGAGAAACCGG - Intronic
1042011892 8:64255668-64255690 TTTTATTTCTTTACAAAAGCAGG - Intergenic
1043147464 8:76676400-76676422 TCTGATTTGTTTATAAACACTGG + Intergenic
1043409669 8:79980547-79980569 TCTCATTTCTTCACTAAAACAGG + Intronic
1043548379 8:81340503-81340525 TTTGATGACTTTATAAAAACTGG - Intergenic
1043732285 8:83697591-83697613 AATGAGTACTTTACAAAAAAAGG + Intergenic
1043988849 8:86727302-86727324 TATGAATACTTTAGCAAAACTGG - Intronic
1044525285 8:93244020-93244042 TGTGATGACTTTTCAAAAAATGG - Intergenic
1046419413 8:113960430-113960452 TATGATTACTTTAAAAATAACGG - Intergenic
1047273174 8:123382132-123382154 ACTGATCAGTTTAGAAAAACGGG + Intronic
1047480906 8:125282064-125282086 TCCGATTTCTCTAGAAAAACTGG - Intronic
1050094394 9:2048146-2048168 TCGGTAAACTTTACAAAAACAGG + Intronic
1051422087 9:16898788-16898810 TCTGCTTATTTTACTATAACAGG + Intergenic
1055014885 9:71605772-71605794 TTTTATTACATTACAAAAAAGGG - Intergenic
1055184141 9:73429877-73429899 TCTGATTAAGTTACTAAAAGTGG + Intergenic
1056155823 9:83836301-83836323 TCTCATTATGTTACTAAAACTGG - Intergenic
1056354709 9:85787266-85787288 TCTCATTATGTTACTAAAACTGG + Intergenic
1056650542 9:88457093-88457115 TCTGATGACATTTCAAAAGCGGG + Intronic
1058008094 9:99941164-99941186 TCTTAATACTTTGCAAAAAGTGG - Intronic
1058111889 9:101039739-101039761 TCTGATGGTTTTAAAAAAACAGG - Intronic
1059305874 9:113352728-113352750 TCTGATTTCCTTACAAAAGGTGG + Intronic
1060306561 9:122418170-122418192 ACTGGTTACTTTACCAAGACTGG - Intergenic
1061094676 9:128448781-128448803 TCTGATGTCCTTACAAAAAGGGG + Intergenic
1186312584 X:8336800-8336822 TCTGATTATTTTTTAAAAAATGG + Intergenic
1187225194 X:17369276-17369298 TCTATTTCCTTTACAAAATCAGG - Intergenic
1189404671 X:40710414-40710436 TCTGACTCCTTTACAGAAAATGG + Intronic
1190144983 X:47882347-47882369 TTTGATTCCATTACAAAGACAGG - Intronic
1195717635 X:107832478-107832500 TTAGTTTACTTTACAAATACAGG - Intronic
1201940355 Y:19452258-19452280 TGTGAATACTTTACAAAATAAGG - Intergenic
1202386874 Y:24334721-24334743 TCTGTTTACTTCACAAAAGAAGG - Intergenic
1202483912 Y:25335407-25335429 TCTGTTTACTTCACAAAAGAAGG + Intergenic