ID: 1028821244

View in Genome Browser
Species Human (GRCh38)
Location 7:95214374-95214396
Sequence CAACAGCCAGTGAGGACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 2, 1: 19, 2: 85, 3: 170, 4: 483}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028821244_1028821250 6 Left 1028821244 7:95214374-95214396 CCTCAGGTCCTCACTGGCTGTTG 0: 2
1: 19
2: 85
3: 170
4: 483
Right 1028821250 7:95214403-95214425 AACATCAGCTCCTTGGGATGTGG No data
1028821244_1028821247 -1 Left 1028821244 7:95214374-95214396 CCTCAGGTCCTCACTGGCTGTTG 0: 2
1: 19
2: 85
3: 170
4: 483
Right 1028821247 7:95214396-95214418 GGCCAGAAACATCAGCTCCTTGG 0: 1
1: 0
2: 3
3: 24
4: 209
1028821244_1028821248 0 Left 1028821244 7:95214374-95214396 CCTCAGGTCCTCACTGGCTGTTG 0: 2
1: 19
2: 85
3: 170
4: 483
Right 1028821248 7:95214397-95214419 GCCAGAAACATCAGCTCCTTGGG No data
1028821244_1028821251 7 Left 1028821244 7:95214374-95214396 CCTCAGGTCCTCACTGGCTGTTG 0: 2
1: 19
2: 85
3: 170
4: 483
Right 1028821251 7:95214404-95214426 ACATCAGCTCCTTGGGATGTGGG 0: 1
1: 0
2: 0
3: 22
4: 195
1028821244_1028821253 29 Left 1028821244 7:95214374-95214396 CCTCAGGTCCTCACTGGCTGTTG 0: 2
1: 19
2: 85
3: 170
4: 483
Right 1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028821244 Original CRISPR CAACAGCCAGTGAGGACCTG AGG (reversed) Intronic
900229153 1:1547529-1547551 CCAGAGGCTGTGAGGACCTGAGG + Intronic
900422951 1:2563463-2563485 CATGGGCCAGTGAGGGCCTGGGG + Exonic
901215566 1:7552967-7552989 CAACAGCCGGTGAGGACAGAGGG + Intronic
901449024 1:9325009-9325031 CAGCAGCCAGTGAGTGGCTGTGG - Intronic
901741388 1:11344231-11344253 CAACAGCAAGGGGTGACCTGGGG + Intergenic
901824420 1:11851372-11851394 CACCAGCCAGCGAGAACCTGTGG - Intergenic
901942948 1:12677737-12677759 CAACAGCCAGTGAAGCCCTGAGG - Intergenic
902213197 1:14918343-14918365 TCACAGCCAATGAGGAACTGAGG + Intronic
902567654 1:17323133-17323155 CAACAGCCAGGGAGGAACTGAGG - Intronic
902638303 1:17749768-17749790 CAATAGCCAGTGAGGAACTGAGG + Intergenic
902687111 1:18085401-18085423 CAACAGCTCATGAGGAACTGAGG - Intergenic
903468590 1:23569016-23569038 GAACACCCAGGGAGGAGCTGTGG + Intergenic
903599986 1:24530392-24530414 CAACAGCAAGGGAGAACCTCAGG + Intronic
903964661 1:27079580-27079602 CAATAGCCAGCTAGGAACTGAGG + Intergenic
904902848 1:33870941-33870963 CAACACCCAGTGAGGAACTCAGG + Intronic
905349642 1:37336424-37336446 CAACCATCAGTGAGGAACTGAGG - Intergenic
905692840 1:39955506-39955528 TACGAGCCAGAGAGGACCTGGGG + Intronic
905847634 1:41245810-41245832 GAACAGCCAGTGGGGCCCTGTGG - Intergenic
906131548 1:43461705-43461727 CAACAGCTGGTAAGAACCTGAGG + Intergenic
907756667 1:57317187-57317209 CAACAGCATGTGAGGAACTGAGG + Intronic
908587163 1:65582421-65582443 CGATAGCCAGGGAGGAACTGAGG - Intronic
908676652 1:66612078-66612100 CAGCTTCCAGTGAGGACCTCAGG + Intronic
909239576 1:73195304-73195326 CAACAACCAGCTAGGAACTGAGG - Intergenic
910006136 1:82399239-82399261 CAACAGCCAGTGAGAATCTGAGG + Intergenic
910020749 1:82586662-82586684 CAATAGCCAGTGAGGAACTGAGG - Intergenic
910762377 1:90746721-90746743 CAACAGCCAGTGAGAAACTGAGG - Intergenic
910769919 1:90820635-90820657 AAACAGCCATTCAGGACTTGAGG - Intergenic
911537614 1:99119345-99119367 CACAAGCCAGTGAGGAAGTGAGG + Intergenic
911557995 1:99368959-99368981 TGAGAGGCAGTGAGGACCTGTGG - Intergenic
911956198 1:104238203-104238225 CCAAAGTCAGTGAGGAACTGAGG - Intergenic
912152420 1:106876544-106876566 TAAGGGCCAGTGAGGAACTGAGG + Intergenic
912248935 1:107991009-107991031 AAACAGCCAGTGAGGACACCAGG - Intergenic
912962231 1:114206617-114206639 TAACAGCCGGTGAGGACCTGAGG - Intergenic
913537083 1:119783369-119783391 CAACAGCCAGTGAGAAATAGGGG + Intergenic
914459469 1:147869717-147869739 CAAAAGCCAGTGAGGAACCAGGG + Intergenic
914840319 1:151242891-151242913 CAACAGCCAGCAAGGAACTAAGG - Intronic
915135742 1:153729983-153730005 AAACAGCCAGTGAAGAGCTAAGG - Intronic
915710343 1:157892029-157892051 CAATGGCCAGTGAAGACCTAAGG + Intronic
916417152 1:164602632-164602654 AAACAGCCAGTCAAGAGCTGTGG - Intronic
917804272 1:178599167-178599189 TAACAGCCAGCAAGGAACTGAGG - Intergenic
918254629 1:182737815-182737837 CAACAACTAGGGAGGATCTGAGG + Intergenic
918533211 1:185546195-185546217 CAACAGCCACTGAGCTACTGAGG - Intergenic
918543849 1:185660271-185660293 CAATAGCCAGTAAGGACCTGAGG - Intergenic
918825539 1:189319067-189319089 CAAGTGCTAGTGAGGATCTGTGG + Intergenic
918868889 1:189940172-189940194 CAACAGCCAGCAAGGAACTGAGG - Intergenic
919171232 1:193956911-193956933 CAACAGTCAGTAAAGAACTGAGG + Intergenic
919256611 1:195133329-195133351 CAACACCCAGTGGGGAAATGGGG - Intergenic
919289493 1:195611020-195611042 CAACAGCCAGCAAGAAACTGAGG + Intergenic
919470191 1:197968934-197968956 CAGGAGCCAGGGAGGTCCTGAGG - Intergenic
919504226 1:198377736-198377758 CAACAGCCAGTGAGAAACTGAGG - Intergenic
920082888 1:203388943-203388965 CAATAGCCAGTGAGAAACTGAGG + Intergenic
920441531 1:205984222-205984244 CAAGAGCCAGTGAGGGTCGGGGG + Intronic
920732566 1:208501470-208501492 CAGCAGCCAGTGAGGAGGAGGGG + Intergenic
921145619 1:212353176-212353198 CAACAGCCAGCCAGGAACTGAGG - Intronic
922537306 1:226390698-226390720 CTCCAGCCAGTGAGGAGCTGAGG + Intronic
923311572 1:232740602-232740624 CAATAGCCAGTAAGGATCTCAGG + Intergenic
923381883 1:233428586-233428608 CAACAGCCAGTGAGGAATTGAGG + Intergenic
924269232 1:242315601-242315623 CAACTGCCGTTGAGGACTTGAGG - Intronic
924416228 1:243859548-243859570 CGACAGCCAGTAAGGACCATGGG - Intergenic
1062976570 10:1688159-1688181 AAACAGCCAGTGGGGACCTGGGG + Intronic
1063339802 10:5252507-5252529 CAGCAGCCATGGAGGGCCTGAGG - Intergenic
1063343929 10:5294144-5294166 CAGCAGCCATGGAGGGCCTGAGG + Intergenic
1064112716 10:12552480-12552502 AAAAAGCCTGTGAGGACCTGGGG + Intronic
1064154263 10:12890535-12890557 CAGCAGCCAGGGAGGAATTGAGG + Intergenic
1064183832 10:13143013-13143035 CAACAGCCAGTGAGGAGAGAGGG - Intergenic
1065641036 10:27783042-27783064 CAACAGCCAGCAAGGAACTGAGG - Intergenic
1065641116 10:27783468-27783490 CAACAGCCAGCAAAGAACTGAGG - Intergenic
1065960181 10:30727735-30727757 ACACTGCCAGTGAGGCCCTGAGG - Intergenic
1066438322 10:35414350-35414372 CAGCAGCCAGCAAGGAACTGTGG - Intronic
1066537390 10:36406755-36406777 CAACAGTCAATGAGGACTCGAGG + Intergenic
1066644504 10:37592230-37592252 CAACAGTCAGTGAAGACCCGAGG + Intergenic
1067547382 10:47203575-47203597 CAACAGCCAGTGAGGAACTGAGG + Intergenic
1067551105 10:47237285-47237307 CTAAAGCCAGTGAGGGCCGGGGG - Intergenic
1068173923 10:53431789-53431811 CATCAGCCTGAGAGGACCTTTGG + Intergenic
1069084944 10:64128032-64128054 AACGAGCCAGTGAGGAACTGAGG - Intergenic
1069580630 10:69563697-69563719 CAAAAGCCAGTGAGGAACTGGGG + Intergenic
1069636048 10:69925664-69925686 GAACAGCCAGCGGGGCCCTGGGG - Intronic
1069731291 10:70616346-70616368 CAACAGCCAGGGATACCCTGAGG - Intergenic
1069953507 10:72035748-72035770 CAGCAGCCTGAGAGGACCTAGGG + Intergenic
1070132171 10:73663686-73663708 AGGGAGCCAGTGAGGACCTGGGG - Intronic
1070232473 10:74583909-74583931 CAATAACCAGTGAGGATCTGAGG - Intronic
1070436633 10:76400188-76400210 CAACAGCCAGTAAGGAACTATGG + Intronic
1071005495 10:80879749-80879771 CAGGAGTCAGTGAGGAACTGAGG - Intergenic
1071609510 10:87020389-87020411 AGGGAGCCAGTGAGGACCTGGGG + Exonic
1071674749 10:87644927-87644949 CAATAGCCAGTGACAGCCTGAGG - Intergenic
1072328187 10:94319071-94319093 CAACAGGCAGTAGGGACCTCAGG + Intronic
1072745262 10:97935072-97935094 CAAGAGGCAGTGAGGACATAGGG + Intronic
1072855697 10:98943747-98943769 CAACAGCTAGATAGGAACTGAGG + Intronic
1072943847 10:99791703-99791725 CAACAGCCAGTGAGAAACTGAGG - Intronic
1073252258 10:102128105-102128127 CAAAAACCAGTGAAGAACTGAGG - Intergenic
1074014275 10:109517899-109517921 CAACAACCAGCATGGACCTGAGG - Intergenic
1074421608 10:113314156-113314178 CAGCAGCCAGGGAAGAACTGAGG + Intergenic
1075154623 10:119964347-119964369 CCACAGCCAGTAAGGAGCTGAGG - Intergenic
1075327957 10:121549722-121549744 CAACAGTCAGTGAGGAACTGAGG + Intronic
1075661911 10:124203257-124203279 TAACAGCCACTGAGAAACTGAGG + Intergenic
1075670184 10:124259143-124259165 TGATAGCCAGTGAGGACCTAAGG - Intergenic
1075817102 10:125272965-125272987 CAACAGCCAGTGGGGGCATGTGG - Intergenic
1075961111 10:126568361-126568383 CAACAGCCAGTAAGGAAATAAGG - Intronic
1076538397 10:131197695-131197717 CACCAGCCAGAGCCGACCTGAGG + Intronic
1077115772 11:883998-884020 CAGCAGTGAGTGTGGACCTGGGG - Intronic
1077294502 11:1819365-1819387 TCTCAGCCAGTGAGGACCTAAGG - Intergenic
1077434903 11:2534266-2534288 AAACACCAGGTGAGGACCTGCGG - Intronic
1077720099 11:4619638-4619660 ATTCAGCCAGTGAGGAACTGGGG - Intergenic
1078521312 11:12066155-12066177 CAACAGCCAGTGAAGACTTGAGG - Intergenic
1078766409 11:14302689-14302711 TAACAGTCACTGGGGACCTGTGG - Intronic
1079728282 11:23905374-23905396 CAACAGCCAGTTAGGACCTATGG - Intergenic
1080192033 11:29562422-29562444 CAACAGCCAAAGAGAACCTGAGG + Intergenic
1080192133 11:29563652-29563674 CCACAGCCAGTAAGTACATGGGG - Intergenic
1080745553 11:35105491-35105513 CAGCAGCCAGAGAGGACCTGAGG - Intergenic
1081547779 11:44083822-44083844 CAGCAGCCACTGTGGACCTGGGG + Exonic
1081763985 11:45596652-45596674 CAGCAGCCAGTGATGACTTGTGG - Intergenic
1081817379 11:45955840-45955862 CAACAGCCAGTGAAGAAGTGAGG + Intronic
1082777034 11:57253621-57253643 CAACAGCCAGTGAGGGATTGAGG + Intergenic
1082798099 11:57393117-57393139 CAACAGCCAAAGAGGTCCTGTGG - Intronic
1083858344 11:65404962-65404984 CAGGAGCCAGTGAGGAGCTGGGG - Exonic
1084051372 11:66602341-66602363 CAACAGCCAAGGAGGACCTGGGG - Intronic
1084224233 11:67705557-67705579 CAACAGCCTGGGAGGAACTGAGG - Intergenic
1084403487 11:68958177-68958199 AAACAGCTAGTGGGGACCAGTGG + Intergenic
1085557944 11:77442483-77442505 CAACAGCCAGGAAGAAACTGAGG + Intronic
1085699098 11:78730401-78730423 CCACAGCCTGGCAGGACCTGTGG + Intronic
1086216140 11:84383655-84383677 CAACAGCCAATAAGAAGCTGAGG + Intronic
1086992370 11:93318103-93318125 TAATAGCCAGTGAAGAACTGTGG + Intergenic
1087096828 11:94327123-94327145 CAACAGCCAGTGAGGAACTGAGG - Intergenic
1087625091 11:100586918-100586940 CAACAGCCAGCAAGCATCTGAGG - Intergenic
1087720088 11:101653212-101653234 CAATAGCCAGTGAGGAACTGAGG + Intronic
1088214068 11:107488570-107488592 CAACAGTCAGTGAGGCACTGAGG - Intergenic
1088445952 11:109928681-109928703 CTGCATCCAGTGAGGGCCTGAGG - Intergenic
1088493911 11:110414126-110414148 CAACAGCCAGAATGGAACTGAGG - Intergenic
1088558694 11:111090234-111090256 CAACAGCCAGCACGGACATGAGG - Intergenic
1088725130 11:112627925-112627947 CAATAGCCAGTGACCAGCTGTGG + Intergenic
1088761394 11:112932247-112932269 CATCATCCAGTGAGGGGCTGTGG - Intergenic
1089183666 11:116599934-116599956 CAACAGCCAGCAAGGAAATGGGG + Intergenic
1090651062 11:128806429-128806451 TGACAGTCAGTGAGGACCTCAGG + Intronic
1090988077 11:131790627-131790649 CAACAGTCTGTGAGGACCCCAGG - Intronic
1091145193 11:133273340-133273362 CAAGAGCCAGTGAGGTGCTGGGG + Intronic
1091289281 11:134428301-134428323 CAACTGGTGGTGAGGACCTGGGG + Intergenic
1091808951 12:3378987-3379009 AAACAGCCAGTGAAGATCGGTGG - Intergenic
1092950846 12:13501541-13501563 CAATAGCTAGTGAGGATCTGAGG - Intergenic
1093086539 12:14871544-14871566 CATCAGCCAATGATGACTTGTGG + Intronic
1093395313 12:18673819-18673841 GAACAGCCAGTGAGCAACTGAGG - Intergenic
1093474610 12:19541019-19541041 CAAGAGCTGGTGAGGACATGAGG - Intronic
1093709788 12:22317529-22317551 TGATAGCCAGTGAGGAACTGAGG - Intronic
1093746712 12:22750586-22750608 CAACAGCTAGTAAGGAACTGAGG + Intergenic
1094091460 12:26654802-26654824 CAACAGCCAGCAAGGAGGTGTGG + Intronic
1094315176 12:29131731-29131753 CAACAGCCAGCAAGGAAATGAGG + Intergenic
1095596731 12:43967573-43967595 TAATAGCCAGGAAGGACCTGAGG + Intronic
1096519155 12:52174380-52174402 CAACAGCCTGTGAGGAGCCTGGG + Intronic
1097182435 12:57179038-57179060 CCAGAGCCAGTGAGCAACTGAGG + Intronic
1097503085 12:60431223-60431245 CAACAGTTAGCAAGGACCTGAGG - Intergenic
1097593247 12:61597415-61597437 CAAGAGCCCATGAGGAGCTGAGG - Intergenic
1098021094 12:66157295-66157317 CAACAGCCAGTGAGAAACTAGGG + Intronic
1098111621 12:67127961-67127983 CAAGAGCCAGTGAGGACCGGAGG + Intergenic
1099084464 12:78227968-78227990 CAACAGCCAGCAATGAACTGAGG + Intergenic
1099404927 12:82248019-82248041 CGTCAACCAGTGAGGAACTGGGG - Intronic
1099867278 12:88299069-88299091 CAACAGCCAGTAAAGAGCTGAGG + Intergenic
1099939203 12:89164854-89164876 CAGTAACCAGTGAGGAACTGAGG + Intergenic
1099939213 12:89164935-89164957 CAGCAACCAGTGAGGAACTGAGG + Intergenic
1100218922 12:92482803-92482825 CAACAACCAGTGAGGAACTAAGG + Intergenic
1100369876 12:93958426-93958448 CAACAGCTAGTGAGGAACTGAGG - Intergenic
1100920293 12:99476957-99476979 TAACAGCCAGTGGGAAACTGAGG - Intronic
1101715221 12:107305368-107305390 CAAGAGCCAGGAAGGACCAGAGG + Intergenic
1101847458 12:108374120-108374142 CAACAACCAGTAAGGAACTGAGG - Intergenic
1101919408 12:108920068-108920090 CAACAGCCAGCAAGGAACTGAGG + Intronic
1102165248 12:110801015-110801037 CAACAGCCAGCAAGAAACTGAGG + Intergenic
1102310035 12:111837454-111837476 CAGCTGCCAGTGAGTACCTAAGG - Intergenic
1102493363 12:113302613-113302635 CAACACGCAGTGAAGACATGAGG + Intronic
1102811175 12:115825205-115825227 CAACAGCCAGCAAGGAGCTGAGG - Intergenic
1102928093 12:116842164-116842186 CAAGAGCCAGTGAGGAACTGAGG - Intronic
1103322970 12:120102395-120102417 CAGCTGCCAGTGAGAATCTGCGG - Intronic
1103878909 12:124150842-124150864 CAACAACCAGGGAGGAGCTGAGG + Intronic
1103996587 12:124834139-124834161 CAACAGCCAGCAGGGGCCTGAGG + Intronic
1104948460 12:132427914-132427936 TAAACGCCAGTGAGGAGCTGAGG - Intergenic
1105892150 13:24689523-24689545 CAAAATCCTGTGAGGAACTGGGG - Intronic
1106172094 13:27297010-27297032 ATACAGCCGGTGAGGAGCTGAGG - Intergenic
1106241927 13:27919968-27919990 CCACAGCCAGCGCGGACCGGCGG - Intergenic
1106266828 13:28118181-28118203 CAACAGCCAGGGAGGACATGAGG + Intergenic
1106562462 13:30858695-30858717 CAACAGCTAGCGAGGGCCTGAGG - Intergenic
1107635045 13:42383672-42383694 CAACAGCCAGCAAGGAAATGAGG - Intergenic
1107675596 13:42793602-42793624 CAACAGCCAGTAAGGAACTGAGG - Intergenic
1107744725 13:43492157-43492179 CAACAGCCAGTAAGAAACTTGGG + Intronic
1108374149 13:49797736-49797758 CTGCAGCCAGTGTGTACCTGTGG + Intergenic
1108766146 13:53631729-53631751 CAATAGCTAATGAGGACGTGAGG - Intergenic
1109193870 13:59356911-59356933 CATCAGCCAGCGAGGAACTGGGG + Intergenic
1110037934 13:70712536-70712558 CAACAGCCAGCAAGGAGCTGGGG - Intergenic
1110284543 13:73734269-73734291 CAATAGACAGTGAGAAGCTGTGG - Intronic
1110385312 13:74904116-74904138 CAACAACCAATGAGAAACTGAGG + Intergenic
1110832913 13:80052465-80052487 CAACAGCCAGAAAGGAACAGAGG + Intergenic
1111332421 13:86777038-86777060 CCACAGCCAGTTTGTACCTGTGG - Intergenic
1111930301 13:94505838-94505860 CAACAGCCAGCAAGGAACTAAGG + Intergenic
1111975339 13:94961587-94961609 TAACAGCCAATGGGCACCTGAGG - Intergenic
1112910152 13:104472504-104472526 CAACAGCCAGAGAGAAACTGAGG + Intergenic
1113039361 13:106088167-106088189 CCCCAGACAGTGAGCACCTGGGG - Intergenic
1113112088 13:106834227-106834249 CAATAGTCAGTGAGGAGCTGAGG - Intergenic
1113164672 13:107426037-107426059 CAGCAGCGAGTAAGGTCCTGAGG - Intronic
1113560722 13:111278520-111278542 CGACACCCAGAGAGGACTTGTGG + Intronic
1113746193 13:112746461-112746483 CAAGTGCCGGTGAGGACGTGGGG - Intronic
1113783707 13:112990833-112990855 CAACGGGCAGGGATGACCTGGGG + Intronic
1113792032 13:113034046-113034068 CAACAGCTACTGACCACCTGTGG + Intronic
1114570980 14:23668300-23668322 TAACAGCCAGAGAGAAACTGAGG - Intergenic
1114813897 14:25932966-25932988 GAACATGCAGTGTGGACCTGTGG + Intergenic
1115137464 14:30128145-30128167 CAACAGCCAGAGAAGACCCGAGG + Intronic
1115494097 14:33985349-33985371 CAACAGTCAGTGAGGACTTAAGG - Intronic
1115598777 14:34935491-34935513 CAACAGCCAGTGAGGAACGGAGG - Intergenic
1115819979 14:37203734-37203756 CTCCAGCCAGTAAGGAACTGAGG + Intronic
1116029701 14:39555954-39555976 CAACAGCCAGTGAGGAACTGAGG - Intergenic
1117617678 14:57550462-57550484 CAACAGACAGTAAGAACATGAGG + Intergenic
1117873621 14:60226454-60226476 TAACAGCCAATGAGGAACTGAGG - Intergenic
1118049570 14:62012320-62012342 CAACAGCCAGCAAGAAGCTGGGG - Intronic
1118168412 14:63360620-63360642 CAACAGCCAGTTAGAAACTGAGG + Intergenic
1119185853 14:72642045-72642067 CAGCAGCTCATGAGGACCTGAGG + Intronic
1119812618 14:77535358-77535380 CTAAAGTCAGTGAAGACCTGTGG - Intronic
1120333480 14:83123649-83123671 CACAACCCAGTGAGGACATGCGG + Intergenic
1120347815 14:83312620-83312642 CAAAGGCCTGTGAGGACCAGGGG - Intergenic
1120394921 14:83956599-83956621 CAAAGGGCAGTGAGGACTTGGGG + Intergenic
1121322891 14:93002867-93002889 AAACAACCAGTGAGGACCATGGG - Intronic
1121656942 14:95604149-95604171 CAACAGTGAGTGAGGAACCGAGG + Intergenic
1121874432 14:97438528-97438550 CAAAAACCAGTGAGAACCTGAGG - Intergenic
1121957233 14:98225729-98225751 CATCAGCCAGTGAGAACGGGAGG - Intergenic
1121964837 14:98294668-98294690 CAAGAGCCAGTGAGTAACTAAGG - Intergenic
1122023127 14:98855848-98855870 CTGCAGCCAGGCAGGACCTGGGG + Intergenic
1122120680 14:99551979-99552001 CATGTGGCAGTGAGGACCTGAGG + Intronic
1122764381 14:104055315-104055337 CCACAGCCACGGAAGACCTGGGG + Intergenic
1123000440 14:105291154-105291176 GTACAGCAAGGGAGGACCTGCGG + Intronic
1123757194 15:23406110-23406132 CAACAGCTAGCAAGGACCTGAGG + Intergenic
1123806500 15:23879429-23879451 CAACAGCCAGCAAGGCGCTGAGG - Intergenic
1123813297 15:23951052-23951074 CAACAGCCAGCAAGGAACTGAGG - Intergenic
1123814822 15:23966347-23966369 CAACAGCCAGCAAGGAACTGAGG - Intergenic
1123854059 15:24388757-24388779 CAACAGCCAGCAAGGAACTGAGG - Intergenic
1123870020 15:24561380-24561402 CAACAGCCAGCAAGGAACTGAGG - Intergenic
1123883557 15:24699182-24699204 CAACAGCCAGCAAGGAACTGAGG - Intergenic
1123887246 15:24738593-24738615 CAATAGCCAGCAAGGAACTGAGG - Intergenic
1124025869 15:25964916-25964938 CAGCAGCCATTGTGGCCCTGTGG + Intergenic
1124861818 15:33449266-33449288 TAACAGCCAGTGAGGACCAGAGG - Intronic
1125147626 15:36490589-36490611 TAATAGCCAGTGAAGACCTGAGG - Intergenic
1125838158 15:42772328-42772350 TAACAGCCAGTAAGGAACTGAGG + Intronic
1125970958 15:43911440-43911462 CAACAGCCAGCAAGGAACTGAGG + Intronic
1126174692 15:45724645-45724667 CAGCAGCCAGAGAGGAGCTGAGG + Intergenic
1126258219 15:46653487-46653509 CAACAGCAAGTGTGGGCATGTGG + Intergenic
1126512046 15:49488924-49488946 TAACAGCCAGTGAGGATCTAAGG - Intronic
1128593926 15:68928130-68928152 CAACAGCCAGTAAGGACCTGAGG - Intronic
1129187236 15:73916361-73916383 CAACAGCAAGCCAGGAGCTGAGG - Intergenic
1129257022 15:74339409-74339431 CAGCAGCCTGGGGGGACCTGGGG + Intronic
1129294430 15:74592126-74592148 CTACATCCAGTGAGGTGCTGGGG - Intronic
1130979627 15:88803631-88803653 CCACAGCCCGAGGGGACCTGCGG + Exonic
1131359841 15:91780882-91780904 CATCAGCCACTGGGGAACTGAGG - Intergenic
1132317846 15:100902892-100902914 CAGCAGCCAGGGAGGACCTGCGG + Intronic
1133741522 16:8655353-8655375 CAGCAGCCAGTGAGGAACTGAGG - Intergenic
1133876745 16:9742002-9742024 CAACAGCCAGAAAGGAACTGGGG + Intergenic
1134459129 16:14416598-14416620 CAACAGCTAGCAAGGACCTGAGG - Intergenic
1134757757 16:16683842-16683864 CAACAGCCAGCTAAGAACTGAGG - Intergenic
1134906261 16:17982319-17982341 CAACAGCGAGAGAAGATCTGAGG - Intergenic
1134909611 16:18012882-18012904 CAATAGCCAGAGAGGATCTGAGG + Intergenic
1134988312 16:18675324-18675346 CAACAGCCAGCTAAGAACTGAGG + Intergenic
1135055121 16:19225712-19225734 CAACAACCAGGAAGGAACTGAGG - Intronic
1135570293 16:23544229-23544251 CAACAGCTAGCAAGGACCTGAGG + Intronic
1138225060 16:55286844-55286866 CAACAGGCAGTGGAGAACTGTGG + Intergenic
1138407286 16:56806600-56806622 CAAGAGCCAGAAAGGACCTAAGG - Intronic
1138606607 16:58094020-58094042 AAGCAGCCAGCGGGGACCTGGGG - Intergenic
1139316134 16:66070654-66070676 CAACAGCCAGCAAGGACTGGAGG - Intergenic
1139508103 16:67409671-67409693 CAACAGCCAGAGAAGTCCCGGGG - Intronic
1140076235 16:71701031-71701053 CAGCAGCTGGTGAGGAACTGAGG + Intronic
1140112678 16:72017209-72017231 CAAAAACCACTGAGGACCTCAGG + Intronic
1140185026 16:72761558-72761580 CAACAGCCAATGAGGACGTGAGG - Intergenic
1140357894 16:74321506-74321528 CAACAGCTAGCAAGGAACTGAGG - Intergenic
1140691583 16:77489752-77489774 CAACAGTCAGCTAGGAACTGAGG - Intergenic
1140940160 16:79713912-79713934 CAACAGCCAGCCAGGAACTAAGG + Intergenic
1140974591 16:80046688-80046710 CAGCAACCAGTAAGAACCTGAGG + Intergenic
1141892542 16:86936164-86936186 CATCACACAGTGAGGCCCTGTGG + Intergenic
1142520265 17:499532-499554 AGACAGCGAGTGAGGACCTGAGG - Intergenic
1142929252 17:3268538-3268560 CAACAGACAGTGAGGCACTGAGG + Intergenic
1143306219 17:5948944-5948966 CAACAGCCAGTGGGGAACTAAGG - Intronic
1147169418 17:38609333-38609355 CTGCAGACAGTGAGGGCCTGGGG + Intergenic
1147769824 17:42859807-42859829 CAACCCCCTGTGAGGACATGAGG + Intergenic
1148650214 17:49244970-49244992 CAATAGCCAGTGAGGAACTTGGG + Intergenic
1148853108 17:50564332-50564354 CAACAGCCAGAGAGGGAATGCGG - Intronic
1149505289 17:57189109-57189131 CCACAGCCAGTAAGAAGCTGGGG + Intergenic
1150157828 17:62868994-62869016 CAACAGCCAGGGAGGATCTGAGG + Intergenic
1150608423 17:66713981-66714003 CTACAGGCTGTGAGCACCTGGGG - Intronic
1150802827 17:68295149-68295171 CAACTGGCAGAGAGGACCTTGGG + Intronic
1150843486 17:68631704-68631726 CAACAGCCAGTGAGGATGTAAGG + Intergenic
1151170229 17:72239471-72239493 TAACAGCCAGGGAGGATCCGAGG - Intergenic
1151902710 17:77027540-77027562 CAGCAGCCAGAGAGGAAATGAGG + Intergenic
1152815684 17:82406277-82406299 TCACAGCCACTGAGGCCCTGAGG + Intronic
1152936360 17:83139771-83139793 AAACAGCCAGTCGGGACCCGCGG - Intergenic
1152936371 17:83139815-83139837 GAACAGCCAGTGAGGACCCGCGG - Intergenic
1152936380 17:83139847-83139869 GAACAGCCAGCCAGGACCCGCGG - Intergenic
1152936389 17:83139879-83139901 GAACAGCCAGCCAGGACCCGCGG - Intergenic
1152936398 17:83139911-83139933 GAACAGCCAGCCAGGACCCGCGG - Intergenic
1152936407 17:83139943-83139965 GAACAGCCAGCCAGGACCCGCGG - Intergenic
1152936416 17:83139975-83139997 GAACAGCCAGCCAGGACCCGCGG - Intergenic
1152936445 17:83140079-83140101 GAACAGCCAGCCAGGACCCGCGG - Intergenic
1152936453 17:83140111-83140133 AAACAGCCAGTCAGGACCCGCGG - Intergenic
1152936463 17:83140155-83140177 GAACAGCCAGTGAGGACCCGCGG - Intergenic
1152936472 17:83140187-83140209 GAACAGCCAGCCAGGACCCGTGG - Intergenic
1152936491 17:83140263-83140285 GAACAGCCAGTGAGGACCCGCGG - Intergenic
1152936500 17:83140295-83140317 GAACAGCCAGCCAGGACCCGTGG - Intergenic
1152936509 17:83140327-83140349 GAACAGCCAGCCAGGACCCGCGG - Intergenic
1152936518 17:83140359-83140381 GAACAGCCAGCCAGGACCCGCGG - Intergenic
1152936537 17:83140435-83140457 AAACAGCCAGCGAGGGCCCGCGG - Intergenic
1153682526 18:7514074-7514096 CTACAGCCAGTGAGCAACTAAGG - Intergenic
1153839853 18:8996912-8996934 CAATAGCCATCGAGGAACTGAGG + Intergenic
1154487411 18:14884276-14884298 TAACAGCCAGTGAGGATCTAAGG + Intergenic
1155073069 18:22333085-22333107 CAACAGCCAGCAAGGAGCTAAGG + Intergenic
1156288990 18:35728877-35728899 CAAATGCCAGTGAGGATGTGGGG + Intergenic
1156355996 18:36340596-36340618 CAGCAGCCAGAGAGAACCAGAGG - Intronic
1156470049 18:37371742-37371764 AAACAGCCAGAGAGGGCTTGGGG + Intronic
1157185704 18:45538501-45538523 CAGCAGCCAGTCAGGAACTGAGG - Intronic
1157573405 18:48728628-48728650 CAACAGCCAGTGAGGAGCCAAGG - Intronic
1157651702 18:49339545-49339567 CAACAGCCAGTGAGGAACTGAGG + Intronic
1157964057 18:52188322-52188344 CAACAGCCTGTGAGGACCTGGGG - Intergenic
1158265666 18:55658274-55658296 CAACAGCCAGAGAGGAACTGAGG + Intronic
1158582323 18:58694868-58694890 CCACAGCCAGTGAGGAAATGAGG - Intronic
1158677953 18:59539344-59539366 CAACAGTCAGCGAAGAACTGAGG + Intronic
1158719628 18:59913209-59913231 CAACTGCCAGTTAGGAACTGAGG - Intergenic
1158985819 18:62815505-62815527 CAACAGCCAGCAAGGAACTAAGG - Intronic
1159219909 18:65447227-65447249 CCACAGCCAGTGAGGAATGGAGG + Intergenic
1159756786 18:72375731-72375753 CCAGAGCAAGTGAGGCCCTGCGG + Intergenic
1159843937 18:73436288-73436310 CAACAGCTAGTGAGAATATGAGG + Intergenic
1159968592 18:74621512-74621534 TCAGAGCCAGTGAGGAGCTGGGG - Intronic
1160191687 18:76719908-76719930 CAAAAGCCAGTTAGCAGCTGAGG + Intergenic
1160579125 18:79873656-79873678 GAACAGACACTGAGGACATGGGG - Intronic
1160965333 19:1744788-1744810 AAACAGCCAGGGTGGACCGGTGG - Intergenic
1161152185 19:2715429-2715451 CAACAGCCAGCGAGGAACTGAGG + Exonic
1161156679 19:2735467-2735489 CAACAGCCAGCCAGGACACGGGG - Intronic
1163107943 19:15137824-15137846 CAACATCCAGTGAGCAACAGTGG - Intergenic
1163391849 19:17035997-17036019 CCACACCCAGAGAGGGCCTGTGG - Intergenic
1164107917 19:22125268-22125290 CAGCAGCCAGAAAAGACCTGTGG + Intergenic
1164274302 19:23703233-23703255 AAAGAGGCAGTGAGGACTTGGGG + Intergenic
1164897478 19:31889959-31889981 CAACACTCATTGAGGACCTGTGG - Intergenic
1165181459 19:33975103-33975125 CAACAGCCAGTGAGAAACTGAGG - Intergenic
1165376785 19:35448663-35448685 CAAGGGCCAGTGAAGGCCTGTGG + Intronic
1165954000 19:39490293-39490315 CTCCAGCCAGTGTGGCCCTGGGG + Exonic
1166546291 19:43636309-43636331 CCACACCCAGGGAGGACCTCTGG - Intronic
1166971071 19:46568277-46568299 CAACAGCCAGCAAGGACCTGAGG - Intronic
1167266320 19:48484683-48484705 GAACAGGCAGTGCCGACCTGAGG + Intergenic
1167318194 19:48778716-48778738 CAACAGCCAGCGAGGAACTAAGG + Intergenic
1167467419 19:49657705-49657727 CAAGGGCCAGTGAGTACCTGCGG - Intronic
1167502993 19:49857814-49857836 CCACAGTCCGTGAGGATCTGGGG - Intronic
1167790893 19:51679474-51679496 CAACAGCTAGAAAGGAACTGAGG - Intergenic
1168285667 19:55331338-55331360 CAGCAGCCGGAGAGGAGCTGAGG - Intronic
925106625 2:1297640-1297662 CAAGAGCCAGGAAGGAACTGCGG - Intronic
925132456 2:1503494-1503516 CCACCGCCAGTGAGGATGTGGGG - Intronic
925467500 2:4120972-4120994 CAACAGCCAGGGACAAACTGAGG + Intergenic
925467851 2:4125650-4125672 CAACAGCCAGGGACAAACTGAGG - Intergenic
925781752 2:7387998-7388020 TGGGAGCCAGTGAGGACCTGGGG + Intergenic
926598837 2:14820014-14820036 CAAATGCCAGTGAGGATGTGAGG + Intergenic
926950897 2:18242236-18242258 CAATAGCCAGTGAGGAACTCAGG + Intronic
928631900 2:33202274-33202296 CAAAAGCCAGTAAGAAGCTGGGG + Intronic
928691215 2:33801235-33801257 CAAGAACCAGCGAGGACCTGAGG - Intergenic
928691227 2:33801330-33801352 CAAGAACCAGCGAGGACCTGAGG - Intergenic
928877729 2:36060387-36060409 CAAAAACCAGTAAAGACCTGAGG + Intergenic
928908059 2:36389319-36389341 TAACAGCCAGCCAGGAGCTGGGG + Intronic
929353725 2:40993677-40993699 CAATAACCATTGAGGACCTGGGG - Intergenic
929404474 2:41625889-41625911 CAACAGCTGGTGAGGAACAGAGG - Intergenic
929422880 2:41812435-41812457 CAACAGCCAGTAAGAAACTGGGG + Intergenic
930621441 2:53648222-53648244 CAACAGCCAGCAAGAAACTGAGG + Intronic
931237575 2:60424372-60424394 CACTAGCCATTGAGGAACTGAGG + Intergenic
931264162 2:60645814-60645836 CAACAGCCAGGAAGGAGCTAAGG + Intergenic
931318143 2:61151594-61151616 CAACAGCCAGGGAGGAACTAGGG - Intronic
931675084 2:64686622-64686644 CAACAGCCCATGAGGGACTGAGG + Intronic
931893907 2:66707282-66707304 AAACAGCCAGTGAGGAGCTGTGG + Intergenic
931969121 2:67566572-67566594 CAACAGCCAGCAAGGACCTGAGG - Intergenic
932946709 2:76241955-76241977 CCACAGCCTGTGAGGACCAAGGG - Intergenic
933037609 2:77420155-77420177 CAACAGCTGGAGAGGACCTGAGG - Intronic
933153321 2:78941115-78941137 CAACAGTCAGTGAGGAAGTGAGG + Intergenic
933200615 2:79444010-79444032 CAACAACCAGTGAAGAACTGAGG + Intronic
933445497 2:82375363-82375385 CAACAGCTAGTGAGGAACTGAGG - Intergenic
933884421 2:86704783-86704805 CAACAGCTAGTGAAGAACTGAGG + Intronic
933898992 2:86835862-86835884 CTGCAGCCAGTGAGGCACTGAGG + Intronic
934020898 2:87950765-87950787 CAGTATCCAGTGAGGAACTGAGG + Intergenic
934568020 2:95351285-95351307 CAGCAGCCAGTGGGACCCTGCGG - Intronic
934898632 2:98139842-98139864 CCACAGCCTGAGGGGACCTGAGG - Intronic
935358248 2:102224944-102224966 CACCATCCAGTGAGGACTGGAGG + Intronic
935612701 2:105042319-105042341 CAACAGCCAGCAAGGACCTGGGG - Intronic
935690554 2:105727493-105727515 CAACAGCCAGTGAGGAACTGAGG + Intergenic
935781554 2:106513364-106513386 CTGCAGCCAGTGAGGCACTGAGG - Intergenic
936224828 2:110639426-110639448 AAAAAACCAGTGAGAACCTGAGG + Intronic
937034915 2:118773106-118773128 CAATAGCCAGCAAGGACCTGAGG + Intergenic
937499816 2:122466249-122466271 CAACAGCCACTGAGGGACTGAGG - Intergenic
938408147 2:131044160-131044182 CAGCAGACAGTGAGATCCTGAGG - Intronic
938823185 2:134978899-134978921 CAATAGGCAGTGAGGAGCAGGGG - Intronic
939140968 2:138354230-138354252 CAAGTGCCAGCAAGGACCTGTGG + Intergenic
940218445 2:151325283-151325305 CAACAGTCAGTGAAGAACTCAGG - Intergenic
940984809 2:160042330-160042352 CAGGAGACAGTGAGGACCTGAGG - Intronic
941245678 2:163093102-163093124 AAACAGGCAGTGAGAACATGTGG - Intergenic
941271816 2:163439468-163439490 CAACAGCCAGTGAGATACTAAGG + Intergenic
941539540 2:166765379-166765401 CAATAGCCTGCAAGGACCTGAGG + Intergenic
943036284 2:182749962-182749984 CAACAGCCAGTGAGGAACTTAGG - Intronic
943931843 2:193864618-193864640 CAACATGCAGTGAGGATGTGAGG + Intergenic
943948661 2:194100420-194100442 CAACAGACAATGAGGACTTAAGG - Intergenic
944189396 2:196985132-196985154 CAACAGCCATCAAGGAACTGAGG + Intronic
944675256 2:202030115-202030137 CAACAGCTAGTGACAGCCTGAGG + Intergenic
945577855 2:211554581-211554603 CAACAGGCAGACAGTACCTGTGG - Intronic
945721311 2:213421587-213421609 CAACTGGGAGTGAGGACTTGTGG + Intronic
945877531 2:215294155-215294177 CAATAGCCAGCAAGGACCTGAGG - Intergenic
945933232 2:215877439-215877461 CAACAGCCACGTAGGAACTGAGG + Intergenic
946431797 2:219630215-219630237 CATCGGCCAGTTATGACCTGCGG + Exonic
946570311 2:221017363-221017385 CAGCAGCCAGTGAGGAACGGAGG - Intergenic
947058680 2:226136960-226136982 CAACCGCCAGTGAGGAAGTGAGG - Intergenic
947070610 2:226283877-226283899 CAACAACCAGTGAGGAAATTGGG + Intergenic
947099187 2:226600995-226601017 CAACAGCCAGTGAGGAATGAAGG + Intergenic
947404174 2:229757299-229757321 CAACAGTCACCGAGGAACTGAGG + Intergenic
947942338 2:234069067-234069089 CAACAGCCTGTAAAGAACTGAGG - Intronic
948244128 2:236463968-236463990 CAACAGCCAGTGAGAAGCTGAGG - Intronic
948690147 2:239696913-239696935 GAGCAGCCTGTGAGGATCTGGGG - Intergenic
1169464202 20:5823191-5823213 CAGCAGCCAGTGAGGGCAGGAGG - Intronic
1169502380 20:6173381-6173403 TAACAGCCAGTGAGAAACTAAGG - Intergenic
1170000683 20:11609937-11609959 CAACAGCCATTGATGATCTGAGG + Intergenic
1170030827 20:11942233-11942255 TAACAGCCAGCAAGGACCTGAGG + Intergenic
1171128527 20:22626585-22626607 CAACAGCTAGTAAGAAACTGAGG - Intergenic
1172219758 20:33265629-33265651 CAATGGCCGGTGAGGAACTGAGG - Intergenic
1172805362 20:37608047-37608069 CTACAGCCAGTGAGGACTGGAGG + Intergenic
1173705109 20:45104345-45104367 CAACAACCAGCCAGGAGCTGCGG + Intergenic
1174270168 20:49362520-49362542 CAACAGCCAGTAAGGAACTGAGG + Intergenic
1174545975 20:51325484-51325506 CAACAGCCAGTGAGGAGCTGAGG - Intergenic
1174598740 20:51706949-51706971 CACAGGCCAGTGAGAACCTGAGG - Intronic
1174701429 20:52612984-52613006 GAACAGCCATTGAGGACCTGAGG + Intergenic
1175271902 20:57739987-57740009 CAACATCCAGTGAGGAGCTGAGG + Intergenic
1175386458 20:58598552-58598574 CACCAGCCAGCGAGGCCCTGAGG + Intergenic
1175550936 20:59817225-59817247 CAATGGCCACTGAGGTCCTGAGG - Intronic
1175590371 20:60185096-60185118 CCACAGCCAGTGAGACACTGTGG - Intergenic
1175693651 20:61084832-61084854 CAACAGCCAGCAAGGAACTGAGG + Intergenic
1176164013 20:63663503-63663525 CCACAGCCTGTGAGGGCCGGGGG + Intronic
1176793871 21:13355059-13355081 TAACAGCCAGTGAGGATCTAAGG - Intergenic
1176929369 21:14789550-14789572 CAACACTCTGTGAGGAACTGAGG + Intergenic
1177147589 21:17423176-17423198 CAACAGCCAGTAAAAAACTGAGG + Intergenic
1177190574 21:17846890-17846912 TAAGAACCAGTGAGGAACTGAGG + Intergenic
1177576426 21:22962471-22962493 CAACAGCCAGCTAGGAAGTGAGG + Intergenic
1177911128 21:27033687-27033709 CAACAGCCAGTGAGGACCTGAGG + Intergenic
1178478826 21:32961565-32961587 CAACATCCATTGAGCACCTACGG + Intergenic
1179990739 21:44947126-44947148 CACCAGCCAATCAGGAGCTGAGG - Intronic
1180082958 21:45494907-45494929 GGACGGCCGGTGAGGACCTGGGG + Exonic
1180127829 21:45804092-45804114 CAGCAGGCAGTGGGCACCTGTGG - Intronic
1181034052 22:20161518-20161540 ACAGAGCCAGTGAGGGCCTGGGG + Intergenic
1181509301 22:23381883-23381905 ACAGAGCCAGTGAGGGCCTGGGG - Intergenic
1181635902 22:24174702-24174724 CAATAACCAGTGAGGACCTGAGG - Intronic
1181881287 22:25982276-25982298 CAACAGCTAGTGAGGAAGTGAGG + Intronic
1182323617 22:29494757-29494779 CAATAGCCAGTAAGGAACTGAGG + Intergenic
1183013519 22:34967274-34967296 CAACAGCCAGAGGGAAACTGAGG + Intergenic
1184042646 22:41953148-41953170 GAACAGCCAGTGAGGACCTTTGG + Intergenic
1184076074 22:42179071-42179093 CAAGTGTCAGGGAGGACCTGGGG + Intronic
1184304288 22:43585027-43585049 CAAAAGCCAGACAGGAACTGAGG - Intronic
1184380760 22:44143653-44143675 CAGGAGGCAGCGAGGACCTGTGG - Intronic
1184534908 22:45079869-45079891 ACACAGCCACTGAGGACATGTGG + Intergenic
1184678814 22:46058769-46058791 GAACTGCCACTGAGGACCAGAGG - Intronic
1184926754 22:47647045-47647067 CAGCAGGCAGTGAGGACCTAAGG - Intergenic
1184958875 22:47914240-47914262 CAAAAGCCAGAGAGGAACTACGG - Intergenic
1185008400 22:48299350-48299372 CAGAAGCCATGGAGGACCTGAGG + Intergenic
1185226910 22:49658387-49658409 CAACCGACAGTGTGGATCTGTGG - Intergenic
1185330347 22:50249459-50249481 CAACAGCCAGCCAGGGCCAGAGG + Intronic
949822540 3:8131710-8131732 CAGCAGCCAGTGAAGAGCTCAGG + Intergenic
950608849 3:14111534-14111556 CAACAGCCAGTAAGGCACTGAGG + Intergenic
950715626 3:14845834-14845856 CACTAGTCAGGGAGGACCTGAGG - Intronic
950898895 3:16478774-16478796 GAACAGGCAGTGAGGAATTGGGG - Intronic
951026143 3:17832429-17832451 CAACAGCCAGTGAGGAACTGAGG + Intronic
951046606 3:18046563-18046585 CAATGGCCAGTGAGGAACTAAGG + Intronic
951171605 3:19548494-19548516 CAACATCCAGTAAGGAACTGAGG + Intergenic
951174216 3:19580161-19580183 CAACATCCAGGGAAGACCAGGGG + Intergenic
951287778 3:20836319-20836341 CAACAGCTAATGAGGATCTGAGG - Intergenic
952039292 3:29241934-29241956 TTACAGGCAGTGAGGAACTGGGG + Intergenic
952482748 3:33778400-33778422 CAACAGCCAGTTAGGAACTGAGG + Intergenic
952502099 3:33973058-33973080 CAACAGCCAACAAGGAGCTGAGG - Intergenic
952627167 3:35419803-35419825 CTACAGCCAGGGAGAAACTGAGG + Intergenic
953178655 3:40576120-40576142 CAAGAGCCAGTGAGAAATTGAGG + Intergenic
953508704 3:43512837-43512859 CATCAGGCAGTGAAGAACTGTGG + Intronic
953536234 3:43778890-43778912 CAACAGCCAGAAAGAACCTGGGG + Intergenic
953584489 3:44187319-44187341 CAACAACAAGTGAGGAGTTGAGG + Intergenic
953680858 3:45036914-45036936 CAACAGCCTCTGAGGACCACTGG - Intergenic
954387013 3:50249403-50249425 CACCTGCCAATGAGGACATGGGG - Intronic
954406587 3:50348628-50348650 CACCAGCCAGGGAAGACCTCAGG - Intronic
955308602 3:57860766-57860788 CAACAGCCAAAGAGTCCCTGAGG + Exonic
955658394 3:61269609-61269631 CAACAGCCAGCAAGGAACTGAGG + Intergenic
955931141 3:64058047-64058069 CAATAGCCAGCCAGGAACTGAGG - Intergenic
956003285 3:64751641-64751663 CAACAGACACTGAGGCCCTTTGG - Intergenic
956702814 3:71973560-71973582 CAACAGCCGAGGAGGAACTGAGG + Intergenic
956731494 3:72200717-72200739 CAACAGCCAGTGAGGAACTAAGG + Intergenic
956877363 3:73476767-73476789 CAATAGCCAGTGAAGACCTGAGG + Intronic
957041001 3:75335512-75335534 CAACAGCCAGTGAGGAGCCAAGG + Intergenic
957041008 3:75335543-75335565 CTACAACCAGTGAGGAGCTGAGG + Intergenic
957352637 3:79046255-79046277 AAACAGTCAGTGAGACCCTGAGG + Intronic
958526637 3:95269357-95269379 CAAGAGAGAGAGAGGACCTGTGG - Intergenic
958888775 3:99759830-99759852 CTACAGCCAGTCAGCTCCTGAGG - Intronic
959002980 3:100986186-100986208 CAATAGCCAGTGAGAAAATGAGG + Intronic
959347702 3:105220328-105220350 CAACAGCCATTGAGGACCTGAGG - Intergenic
959348420 3:105229180-105229202 CAACTGTCAGTGAGAAACTGAGG + Intergenic
960094658 3:113677679-113677701 CAGCAGCTAGTGAGGACCTAAGG - Intronic
960146347 3:114208047-114208069 CAACAGCCAGTGAAGACGTGAGG + Intergenic
960959087 3:123056531-123056553 CAACCGCCAGTGAAGTGCTGAGG - Intergenic
961045806 3:123707167-123707189 CAACAGCCAGTGAGGAGCCGAGG + Intronic
961045814 3:123707198-123707220 CTACAACCAGTGAGGAGCTGAGG + Intronic
961329653 3:126131038-126131060 CTGCAGCCAGGAAGGACCTGCGG + Intronic
961425865 3:126847329-126847351 CAACAGCCAGTGAGGACCGGAGG - Intronic
962218273 3:133541521-133541543 CAACAGCCAGCAAGAAACTGAGG + Intergenic
963113657 3:141707571-141707593 AAAGACCCAGTGAGGACTTGGGG + Intergenic
963239370 3:142987932-142987954 CAAAAGCCAGTGAAGAAATGAGG - Intronic
963469928 3:145727625-145727647 CAACAGCCAGTGATGTACTGAGG + Intergenic
963560841 3:146862855-146862877 TAATAGCCAGTTAGGAACTGAGG + Intergenic
963905214 3:150767930-150767952 CAACAGCTAGTGAGAACCCTGGG + Intergenic
964866809 3:161271190-161271212 CAACAGCCAGTGAGGCCCTAAGG + Intergenic
965382154 3:168003144-168003166 CAACAGCCTGTGAGGAGCTGAGG - Intergenic
965617212 3:170606902-170606924 CAACAGTGAGTGAGGAGCTGAGG - Intronic
966988882 3:185208212-185208234 CCACAGTCAGTGAGGAACTGAGG + Intronic
967143831 3:186588797-186588819 CAACAGCCTGTTAGGAAATGAGG + Intronic
967723317 3:192838147-192838169 CAGCAGTCAGTGAAGAACTGAGG - Intronic
968001171 3:195207850-195207872 CAGCAGCCAGGGAGGATCTGAGG - Intronic
968648988 4:1753020-1753042 CACCAGCCTGTGGGGACTTGGGG + Intergenic
969140459 4:5066768-5066790 CAACATACAGTAAGGTCCTGGGG - Intronic
971049441 4:22844656-22844678 CAACAGCCAGTGAAGAACTGAGG - Intergenic
972148819 4:36064261-36064283 CCACAACCAGTGCAGACCTGAGG - Intronic
972731622 4:41800673-41800695 CAATAGCCAGAGAGAAACTGAGG - Intergenic
972744196 4:41917156-41917178 CCACAGCAAGTGAGGTGCTGAGG - Intergenic
972894240 4:43598965-43598987 CAACAACCAGTAAGGAACTAAGG + Intergenic
973684544 4:53356120-53356142 CAACAGCCAATGAGGAACTGAGG - Intronic
974080451 4:57206849-57206871 CAACAGCCAGTGAGAAACTGAGG + Intergenic
974383952 4:61180601-61180623 CAACAATTAGTGAGGACCTGAGG + Intergenic
975264690 4:72348814-72348836 CAACAGCCAGCAAGGAAATGAGG + Intronic
975585387 4:75943034-75943056 CAAGAGCCAGAGAGGAACTGAGG + Intronic
976214977 4:82707681-82707703 CAACAGCCAGTAAGGAAATGAGG + Intronic
976673869 4:87683208-87683230 CAACAGCCAGCAAGGAACTGTGG - Intergenic
976953036 4:90857327-90857349 TAACAGCTACTGAGGAACTGTGG - Intronic
977116544 4:93035682-93035704 CAATAGCCAGTGAGGATTTGAGG - Intronic
978936609 4:114385144-114385166 CAAAAGTCAGCGAAGACCTGAGG - Intergenic
979186012 4:117794076-117794098 CAACATCCAGTGAGGAAATGGGG + Intergenic
980091871 4:128451346-128451368 CAACAGCCTGTGAGAAACTGGGG - Intergenic
980289049 4:130821658-130821680 CAAATGCAAGTGAGGACATGGGG - Intergenic
980423152 4:132591083-132591105 CAACAGCCAGTGAAAAACTGAGG + Intergenic
980476097 4:133318887-133318909 CAACTGCCAATAAAGACCTGAGG - Intergenic
980591189 4:134891345-134891367 CTACAGCCAGTGATGAATTGGGG - Intergenic
982857480 4:160403261-160403283 CAACAGCCAGTGAGGAGCTGAGG + Intergenic
983091198 4:163504887-163504909 CAACAGCTAGTGAAGAAGTGAGG - Intronic
983903682 4:173163409-173163431 CGCCTGCCAGTGAGGAACTGAGG + Intergenic
985106128 4:186501680-186501702 GACCAGCCAGAGAGGACCAGAGG + Intronic
985236464 4:187880705-187880727 CAGCAGCCAGCAAGGGCCTGAGG - Intergenic
985543239 5:496391-496413 TAACAGCCTCTGACGACCTGTGG + Intronic
985655665 5:1130328-1130350 CAACACCCAGCGAGGACAGGAGG + Intergenic
985790304 5:1923171-1923193 CAACATCCAGAGAGGGCCTGGGG - Intergenic
985879636 5:2628545-2628567 CGCCAGCCAGCGAGTACCTGGGG - Intergenic
985970782 5:3376887-3376909 CCACAGCCCTTGAGGACCCGAGG - Intergenic
986058644 5:4165104-4165126 GAACAGCCAGTGATGTGCTGGGG - Intergenic
986216842 5:5727212-5727234 AGACAGCCAGTGAGGAACAGGGG + Intergenic
986398482 5:7355009-7355031 AAGCAGGCAGTGAGGACATGGGG + Intergenic
986625709 5:9722141-9722163 CAACAGCTGGTAAGGACCTGAGG + Intergenic
986859854 5:11914168-11914190 CAACAGCCAGTGAGCAACTGAGG + Intergenic
986976941 5:13405694-13405716 CACTAGCCAGTGAGGACCTGAGG - Intergenic
987261280 5:16206015-16206037 CAATACCCAGGGAGGAGCTGAGG - Intergenic
987386831 5:17338101-17338123 CAGCAGCCAGTGAGGAACTGGGG - Intergenic
988634290 5:32965907-32965929 CAACAGCCAGTGAGAAACTGAGG - Intergenic
989483633 5:41962516-41962538 TAAAAGACAGTGATGACCTGTGG - Intergenic
991962702 5:72061855-72061877 CCATAGCCAATGAGGACATGTGG - Intergenic
992017124 5:72586837-72586859 GAACAGCCCGTGAAGAACTGAGG + Intergenic
992035577 5:72771633-72771655 CAACAGCCCATGAGAAACTGAGG - Intergenic
992217728 5:74542489-74542511 CAGCAGCCATTGAGGGTCTGAGG + Intergenic
992277982 5:75140767-75140789 CAATCACCAGTGAGGAACTGAGG + Intronic
992901889 5:81305035-81305057 CAACAGACAGTGAGGAAGTAAGG + Exonic
993201766 5:84825760-84825782 CAACAGCCAGTGAGAATCTGAGG - Intergenic
993918650 5:93772738-93772760 CAAAAGCCAGGGAGGACCTGAGG - Intronic
994855739 5:105116288-105116310 CAACAGCCAGCAAGAAGCTGAGG - Intergenic
995062104 5:107822277-107822299 CAACATCCAATGAGAACCTGAGG + Intergenic
995435977 5:112135740-112135762 CAACAGACAGTGAGGATCTGAGG + Intergenic
995491579 5:112698066-112698088 CAAAAGCTAGTGAAGAACTGAGG - Intergenic
995590270 5:113692693-113692715 CCTCAGGCAGTGAGGTCCTGAGG + Intergenic
995631355 5:114136300-114136322 CAAGAGCAAGTGAGCACGTGAGG - Intergenic
996097655 5:119415673-119415695 CAACAGCCAGAAAAGACCCGGGG + Intergenic
996548611 5:124707185-124707207 CGACAGCCAGTGAGGATAGGTGG + Intronic
996581710 5:125038627-125038649 CGAGAGAGAGTGAGGACCTGTGG - Intergenic
996641836 5:125763546-125763568 CAACCGCCAGAGAGAAACTGAGG + Intergenic
996855260 5:127998771-127998793 CAACAGCCAATGAGAAACTGAGG + Intergenic
997313432 5:132910654-132910676 CAACAGTCAGTCAGTAGCTGAGG + Intronic
997720307 5:136073357-136073379 CGACAGCCAGTGAGGGAATGGGG + Intergenic
998799304 5:145853122-145853144 CAACAGCCAGCAAGGAACTGAGG - Intergenic
999797412 5:155001528-155001550 CAACAGCCACAGAACACCTGGGG + Intergenic
999801584 5:155043315-155043337 TAACAGTCAGTGAGGAAATGGGG - Intergenic
1001208842 5:169791231-169791253 CATCAGACAGTGAGAGCCTGGGG - Intronic
1001770423 5:174292042-174292064 CAACAGCTAGTGAGAAACTGAGG - Intergenic
1002536729 5:179879964-179879986 CAGCAGCCAGAGAGGAGCTGAGG - Intronic
1003115032 6:3277956-3277978 CAACGGCCAGCAAGGAGCTGAGG + Intronic
1003504739 6:6731039-6731061 CCACAGCCAGCAAGGAACTGAGG - Intergenic
1004250618 6:14020336-14020358 CTACAGCCAGTGAGGAACTGAGG - Intergenic
1004722160 6:18277292-18277314 CAGCAGCCAGAGAGGCTCTGAGG + Intergenic
1005693405 6:28329062-28329084 CAACAGCCAGTGAGTAGCTGAGG + Intronic
1006046674 6:31304959-31304981 CACCAGCCAGTAAGGAACTGAGG + Intronic
1006445789 6:34079114-34079136 CAAGAGCCAGTGAGGAACAGTGG + Intronic
1006587697 6:35128269-35128291 CAATAGCCAGTAAGAAGCTGGGG - Intronic
1006986576 6:38179588-38179610 CAACTGCCTGAGAGGTCCTGAGG - Intronic
1007031471 6:38631616-38631638 CAACAGCCAGCAAGGAACTGAGG + Intronic
1007182728 6:39942049-39942071 CAACAGCCAGTTAGGAACGAAGG + Intergenic
1007992454 6:46270816-46270838 CAACAACCAGAGAGGAACCGAGG + Intronic
1008730708 6:54479503-54479525 CAACAGCCAGTGAAGAACTGAGG + Intergenic
1008914532 6:56773016-56773038 CAACAGCAAGCAAGGAACTGAGG + Intronic
1011060535 6:83261583-83261605 GAACATCCAGTGAGGAAGTGAGG + Intronic
1011399457 6:86944030-86944052 CAGCAGCCAGCTGGGACCTGAGG - Intronic
1012144101 6:95659870-95659892 AAACAACCGGTGAGGAACTGAGG + Intergenic
1012729802 6:102867520-102867542 CGAGAGCCACTGAGGACCAGAGG - Intergenic
1012806647 6:103903196-103903218 CAACAGCCAGCAAGAAGCTGTGG - Intergenic
1013041066 6:106434094-106434116 CAATAGCCATTGAGGAACTGAGG - Intergenic
1013865323 6:114689646-114689668 CAACAACCTGTGAGGAACTGTGG + Intergenic
1014125429 6:117771597-117771619 CAACAGCCAGTGAGGAACTGAGG - Intergenic
1015177019 6:130321282-130321304 CGAGAGCCAGTGAGCACCTGGGG + Intronic
1015216537 6:130756391-130756413 CAACAGCTTCTGAGGAACTGAGG + Intergenic
1015448732 6:133339639-133339661 CGACAGCCAGAAAGGGCCTGTGG + Intronic
1015651370 6:135464709-135464731 CCAAAGCCAGTCAGGACCTGAGG + Intronic
1015824149 6:137294135-137294157 CAACAGTCAGAGAGAAGCTGAGG + Intergenic
1016950618 6:149576238-149576260 CAACATCTGGTGAGGAACTGAGG - Intronic
1018071320 6:160167044-160167066 CAGCAGCCAGTGTGGACCTCAGG - Intergenic
1018217754 6:161546897-161546919 CAACAGCCAGTGAGGAACTGAGG + Intronic
1018786848 6:167114825-167114847 CTGCATCCAGTGAGGACCTGAGG + Intergenic
1018804952 6:167251542-167251564 CAACAGTCAGTGAGGAACTGAGG + Intergenic
1019449346 7:1088813-1088835 CCACCTCCAGTGAGGACGTGGGG + Intronic
1019606825 7:1914123-1914145 GAAGAGCCAGTGAGGGCGTGTGG - Intronic
1019643663 7:2117867-2117889 CAAAGGCCAGTGGGGCCCTGTGG - Intronic
1019897581 7:3994790-3994812 CAACAGCCAGTTAGGGTCAGTGG - Intronic
1020222117 7:6247314-6247336 AAACAGCCAGTCAGAACCTGGGG - Intronic
1021094571 7:16521104-16521126 CAACAGCCAGAGAGGGCTTGTGG - Intronic
1021242257 7:18218019-18218041 CAATAGCCAGTGAGGAACTAAGG - Intronic
1021457935 7:20849526-20849548 CAACAGCCAGTCAACACCTGAGG - Intergenic
1021645775 7:22788186-22788208 CAACTGCCAGCAAGGAACTGAGG - Intergenic
1022039423 7:26566050-26566072 CAACAGCCTGCAAGGAGCTGAGG - Intergenic
1022459252 7:30588401-30588423 CAATAGTCAGTGAGGACCTGTGG - Intergenic
1024439820 7:49404082-49404104 CAACAGCCAGCAAGGAGCAGAGG + Intergenic
1024612399 7:51078833-51078855 CAACTGCCAGCGAGGCGCTGAGG - Intronic
1024732737 7:52271499-52271521 CAAAGGCCAGTGATGACCAGTGG + Intergenic
1025174120 7:56788351-56788373 CCACAGCCAGAGAGGACCTGAGG - Intergenic
1025697676 7:63788074-63788096 CCACAGCCAGAGAGGACCTGAGG + Intergenic
1025829399 7:65036757-65036779 CAACAGCCAGAGAGGACCTCAGG + Intergenic
1025916617 7:65871697-65871719 CAACAGCCAGAGAGGACCTCAGG + Intergenic
1025971573 7:66331090-66331112 CAACAGCCAGTGAAAACCTGAGG - Intronic
1025978013 7:66384921-66384943 TACCAGCCAGTGGGGAGCTGAGG - Intronic
1026595559 7:71731676-71731698 CAACAGCCAGTAAAGAACAGAGG - Intergenic
1027203595 7:76079588-76079610 TACCAGCCAGTGGGGAGCTGAGG - Intergenic
1027798531 7:82723189-82723211 TGACAGCCAGTAAGGACCTGAGG + Intergenic
1028073334 7:86479312-86479334 CAACAGCAAGTAAGAAACTGAGG + Intergenic
1028451978 7:90995287-90995309 CAACAGCCAGTGTAAACCTGAGG + Intronic
1028821244 7:95214374-95214396 CAACAGCCAGTGAGGACCTGAGG - Intronic
1028962467 7:96764556-96764578 CAACAGGCAGTGCAGATCTGTGG + Intergenic
1029490741 7:100868654-100868676 GCACAGCCAGTGAGGGGCTGCGG + Exonic
1029959866 7:104679210-104679232 CAACAACCAGTAAGGAGCTGAGG - Intronic
1029985934 7:104923307-104923329 CAACAGCCAGCAAAGAACTGAGG + Intergenic
1030093780 7:105879394-105879416 CATCAGCCAGTGGGGAACTGAGG + Intronic
1030348877 7:108461249-108461271 CAACAGCCTGTGAGGAACTGAGG + Intergenic
1030405130 7:109101105-109101127 CAATAACCAGCAAGGACCTGTGG - Intergenic
1032288432 7:130562912-130562934 CAACAGCCACTGACCACATGTGG + Intronic
1032292568 7:130601946-130601968 CAACAGCCAGGGAGAAACTGAGG + Intronic
1032464071 7:132132911-132132933 GAACCACCACTGAGGACCTGGGG - Intronic
1033051055 7:138004621-138004643 CAACAGCCAGTGAGGATCTGAGG + Intronic
1033302235 7:140196766-140196788 CAACAGCCAGTGAGGAACCGAGG + Intergenic
1033488629 7:141817683-141817705 CAACAGCCAGTGAGGAACTGAGG + Intergenic
1033631215 7:143159885-143159907 CAACAGCTAGCAAGGAACTGAGG + Intergenic
1034164078 7:149012497-149012519 CAACAGCACCTGAGGGCCTGAGG - Intronic
1034733498 7:153408947-153408969 CAACAGCCAGTGAGGGTCTGAGG + Intergenic
1036534513 8:9633779-9633801 CAGTAGCCAGTGAGAAACTGAGG + Intronic
1036805997 8:11834230-11834252 CAACTGCTCGTGAAGACCTGGGG - Intronic
1037019217 8:13947503-13947525 CAGCAGGCAGTAAGGAACTGAGG + Intergenic
1037789455 8:21924132-21924154 CAACAGCCAGTGAGGAACTGAGG - Intronic
1038403068 8:27300125-27300147 CTACAGCCAGTGAGGGACTCAGG + Intronic
1038682011 8:29677432-29677454 CAATAGACAGTGAGGAAATGAGG - Intergenic
1038697440 8:29818795-29818817 CAACAGTCACTGAGGAGCAGAGG + Intergenic
1039132645 8:34285003-34285025 CAACAGCCACTAAAGAGCTGAGG + Intergenic
1039576635 8:38628911-38628933 CGACAGCTAGTGAGCAACTGAGG + Intergenic
1039990881 8:42486636-42486658 CATCAGGCAGTGAGGCCCAGAGG - Intronic
1041331566 8:56731691-56731713 CAACAGCCAAAAAGGAACTGAGG - Intergenic
1041332135 8:56738318-56738340 CACCAGCCAGTGAGCACAGGTGG - Intergenic
1041575294 8:59387218-59387240 CAACTGCCAGTGAAGAACAGAGG + Intergenic
1042243719 8:66690155-66690177 CGACAGTCAGTGAGGACCTGTGG - Intronic
1042323590 8:67504580-67504602 CCACAGCCAGTGAGGACTTATGG + Intronic
1042901413 8:73732170-73732192 CAACAGCCAACAAGGAACTGAGG - Intronic
1043505183 8:80895501-80895523 CAACAGCCAGCAAGGATCTGAGG + Intergenic
1043776255 8:84273308-84273330 CCAAAGCCAGAGAGGACCTGAGG - Intronic
1043785484 8:84393311-84393333 CAACAGCCAGTAAGAAACTGAGG - Intronic
1043929529 8:86075083-86075105 CAACAGCCAGCTGGGAACTGAGG - Intronic
1044607837 8:94062529-94062551 TGCCAGCCAGTGAGGAGCTGGGG - Intergenic
1045372061 8:101534340-101534362 AAACAGCCGGTGAGGAACTGAGG - Intronic
1045406538 8:101872208-101872230 CCAAAGCCAGTGAGGGCTTGTGG - Intronic
1045479348 8:102579854-102579876 CAACAGTCAGTGAGGACCTGAGG + Intergenic
1045532273 8:102996298-102996320 CAGCAGCCACTCAGGACCTCTGG - Intergenic
1046224839 8:111264269-111264291 CAATGGCCAGTGAGAACCTGAGG - Intergenic
1047258197 8:123232645-123232667 CACCAGCAAGTGAAGGCCTGCGG + Intronic
1047305203 8:123647220-123647242 TTACAGCCAGTGAGTTCCTGGGG - Intronic
1048675464 8:136773717-136773739 CAATGGCCAGTGAGGAACTGAGG - Intergenic
1048973357 8:139657437-139657459 CAGGAGCCGGGGAGGACCTGTGG + Intronic
1049248809 8:141577319-141577341 CCAGAGCCAGAGAGGAGCTGTGG - Intergenic
1049446028 8:142632069-142632091 CGACAACCAGTGAGGAACTGAGG - Intergenic
1049539777 8:143203022-143203044 CAAGAGCCAGCGTAGACCTGTGG - Intergenic
1050303598 9:4284116-4284138 CACCAGCCAGTAAGGAGCTTGGG - Intronic
1051376004 9:16403631-16403653 CAACAGCCAGAGAGGAACTGAGG - Intergenic
1051749842 9:20329267-20329289 CAACTGCCAGCAAGGAACTGGGG + Intergenic
1052745108 9:32432971-32432993 GAACAGCCAGTGAGAAACGGAGG - Intronic
1053884325 9:42631265-42631287 TAAGAGCCAGTGAGGATCTAAGG - Intergenic
1053888343 9:42663029-42663051 TAAGAGCCAGTGAGGATCTAAGG + Intergenic
1054223348 9:62438712-62438734 TAAGAGCCAGTGAGGATCTAAGG - Intergenic
1054227362 9:62470475-62470497 TAAGAGCCAGTGAGGATCTAAGG + Intergenic
1054714378 9:68542477-68542499 CAACAGTCACTGAAGAACTGAGG + Intergenic
1055470244 9:76603606-76603628 CAACAGCCAGAGAGTACCTGAGG - Intergenic
1055745005 9:79433882-79433904 CAATAGCCAGAGAGGAACTGAGG - Intergenic
1056080343 9:83086680-83086702 CAACAGCCAGTGAGGAACTGAGG - Intergenic
1056133775 9:83610409-83610431 CAACAGCCAGCAAGAAACTGAGG + Intergenic
1056683105 9:88737218-88737240 CAACAGCCAGCCAAGACCTCAGG - Intergenic
1056804091 9:89714481-89714503 CAACAGCCAATGAGGAGCCAAGG - Intergenic
1057133777 9:92672247-92672269 CAACAGAGAGAGAGGACCTTAGG + Intergenic
1057965335 9:99497896-99497918 CAACAGCCAGTGAAGAACTGAGG - Intergenic
1058101319 9:100920431-100920453 CAGCAGCCAGTGAGAAACTGAGG - Intergenic
1058543371 9:106035357-106035379 CAATAGCCAGAGAGAAACTGAGG - Intergenic
1059508028 9:114817619-114817641 CAACAGACACTGAGTATCTGTGG + Intergenic
1059689554 9:116671757-116671779 CAAAAGCCAGCAAGGAACTGAGG + Intronic
1059849838 9:118325586-118325608 CAATAGCCACTGAGAATCTGAGG + Intergenic
1060165670 9:121412264-121412286 CAACAGCCAGAAAGGAACTGAGG - Intergenic
1061475353 9:130861983-130862005 CTACAGCAGGTGAGGACCTAGGG - Intronic
1061595287 9:131624886-131624908 CAACACCCACTGAGGAGCTGGGG + Intronic
1062082644 9:134632537-134632559 CGACAGACACTGAAGACCTGGGG - Intergenic
1062124774 9:134854205-134854227 CAACAGCTAGTCACCACCTGAGG - Intergenic
1062200820 9:135301805-135301827 CAACAGGCCGTGAGCTCCTGTGG - Intergenic
1062446881 9:136598893-136598915 CCAAAGGCAGTGAGGGCCTGGGG - Intergenic
1186099146 X:6136514-6136536 CAACAGCCAGCAAGGAACAGAGG - Intronic
1186386715 X:9117297-9117319 CAACAGCCAGCTAGAAACTGGGG + Intronic
1186413314 X:9362334-9362356 GCAGGGCCAGTGAGGACCTGTGG + Intergenic
1186861051 X:13672975-13672997 CAACAGCCAGAGTGATCCTGGGG + Intronic
1186874119 X:13800209-13800231 CAGCAGCTTGTGAGGAACTGAGG + Intronic
1186954548 X:14668137-14668159 CAATAGCCAGTGAAGAGCTGAGG - Intronic
1187246546 X:17557833-17557855 CAACACCCAGTGAAGAACTGAGG - Intronic
1187456875 X:19449037-19449059 CAACAGCCAGTTAAGAGCTCTGG + Intronic
1187638638 X:21262180-21262202 CAACAGTCAGTAAAGAACTGAGG + Intergenic
1187687624 X:21831253-21831275 CAACAGCCAGTGACGAACTGAGG - Intergenic
1187912272 X:24121923-24121945 TAACAGCCAGCGAGAAACTGAGG - Intergenic
1188154698 X:26726419-26726441 CAACAGCCAGTAATCAGCTGGGG + Intergenic
1188421702 X:29997473-29997495 CAACAGCCAATGAGGAAATGAGG - Intergenic
1188838658 X:34988750-34988772 AAAGTGGCAGTGAGGACCTGGGG - Intergenic
1189127937 X:38467809-38467831 CAAGAGCTAATGAGGAACTGAGG + Intronic
1189174369 X:38940262-38940284 CAATAGCCATTGAGGAACCGAGG + Intergenic
1189256775 X:39645864-39645886 CACCAGCCAGTGAGGCCATGCGG - Intergenic
1189317643 X:40067236-40067258 CAACAGGCAGTGACTAACTGGGG + Intronic
1189374387 X:40455341-40455363 CAGCAGCCAATGAGGCCCTGAGG - Intergenic
1189689883 X:43604956-43604978 CAACAGCCAGCAAGGAACTGAGG + Intergenic
1190295507 X:49024773-49024795 TAACAGCCAGCAAGGAACTGGGG + Intergenic
1190408037 X:50106993-50107015 CAACAGCAAGCTAGGAACTGAGG - Intergenic
1190843984 X:54174055-54174077 CAACACTCAGTGAGGAACTGAGG - Intronic
1192193287 X:69010487-69010509 CAGCAGCCAGAGAGGAACTGAGG - Intergenic
1192208481 X:69111391-69111413 CAAGTGGCAGTGAGGCCCTGAGG + Intergenic
1192632797 X:72790244-72790266 CAACAGCCATAGAGGAACTGAGG - Intronic
1192648912 X:72930557-72930579 CAACAGCCATAGAGGAACTGAGG + Intronic
1193265189 X:79460270-79460292 CAACAAACAGTTAGAACCTGAGG - Intergenic
1193386601 X:80880167-80880189 CAACAGCCAGGCAGAATCTGAGG - Intergenic
1193978451 X:88152139-88152161 CAGCAGCCAGTGAGAAACTGAGG - Intergenic
1195067944 X:101254426-101254448 CCACATCCAGTGAGAACATGAGG + Exonic
1195252240 X:103060434-103060456 CAACAGCCAGTGAGGAACTCAGG - Intergenic
1195916396 X:109940456-109940478 CAACAGCCAGAGAGACACTGAGG - Intergenic
1196711498 X:118768467-118768489 CAGCAACCAGTGAGGTACTGAGG - Intronic
1196769607 X:119280793-119280815 CCACAGCCATTGAGCAACTGAGG + Intergenic
1197534380 X:127669479-127669501 CAACAGCCAGGGAGGAACTGAGG - Intergenic
1197796176 X:130300438-130300460 AAACAGCCAGTAAGGACTTTTGG - Intergenic
1198063909 X:133076725-133076747 CAACAACCAGTAAGGATCTGAGG + Intronic
1198504303 X:137286092-137286114 CAACAGCCAGCAAGGAACCGAGG - Intergenic
1198678524 X:139156563-139156585 CAACAGCCAGTTAGAAACCGAGG + Intronic
1198987412 X:142471499-142471521 CAACACACAGTGAGGACAAGTGG + Intergenic
1199001774 X:142647369-142647391 CAACAGCCAGCAAGGAAATGGGG + Intergenic
1199123624 X:144088362-144088384 CAGTATCCAGTGAGGAACTGAGG - Intergenic
1200116956 X:153773636-153773658 CCACAGCCAAGGAGGAGCTGTGG + Exonic
1200962308 Y:9006778-9006800 CAATAGCCTGTGAGCTCCTGAGG - Intergenic
1202103715 Y:21339248-21339270 TAATAGCCAGTTAGGAACTGAGG - Intergenic
1202370285 Y:24191501-24191523 CAAAGGCCAGTGAGGGCTTGTGG + Intergenic
1202500499 Y:25478616-25478638 CAAAGGCCAGTGAGGGCTTGTGG - Intergenic