ID: 1028821249

View in Genome Browser
Species Human (GRCh38)
Location 7:95214398-95214420
Sequence TCCCAAGGAGCTGATGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8950
Summary {0: 1, 1: 0, 2: 3, 3: 282, 4: 8664}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028821249_1028821253 5 Left 1028821249 7:95214398-95214420 CCAGAAACATCAGCTCCTTGGGA 0: 1
1: 0
2: 3
3: 282
4: 8664
Right 1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG No data
1028821249_1028821258 29 Left 1028821249 7:95214398-95214420 CCAGAAACATCAGCTCCTTGGGA 0: 1
1: 0
2: 3
3: 282
4: 8664
Right 1028821258 7:95214450-95214472 AACTTGCTTCCCAATAGTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 128
1028821249_1028821257 28 Left 1028821249 7:95214398-95214420 CCAGAAACATCAGCTCCTTGGGA 0: 1
1: 0
2: 3
3: 282
4: 8664
Right 1028821257 7:95214449-95214471 CAACTTGCTTCCCAATAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028821249 Original CRISPR TCCCAAGGAGCTGATGTTTC TGG (reversed) Intronic
Too many off-targets to display for this crispr