ID: 1028821252

View in Genome Browser
Species Human (GRCh38)
Location 7:95214413-95214435
Sequence AGGGAGAGGCCCACATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028821252_1028821257 13 Left 1028821252 7:95214413-95214435 CCTTGGGATGTGGGCCTCTCCCT 0: 1
1: 0
2: 3
3: 55
4: 366
Right 1028821257 7:95214449-95214471 CAACTTGCTTCCCAATAGTGAGG No data
1028821252_1028821258 14 Left 1028821252 7:95214413-95214435 CCTTGGGATGTGGGCCTCTCCCT 0: 1
1: 0
2: 3
3: 55
4: 366
Right 1028821258 7:95214450-95214472 AACTTGCTTCCCAATAGTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 128
1028821252_1028821253 -10 Left 1028821252 7:95214413-95214435 CCTTGGGATGTGGGCCTCTCCCT 0: 1
1: 0
2: 3
3: 55
4: 366
Right 1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028821252 Original CRISPR AGGGAGAGGCCCACATCCCA AGG (reversed) Intronic
900207222 1:1436717-1436739 AGAGAGAGCCCTAGATCCCATGG + Intronic
900255863 1:1697982-1698004 AGGGCGGGGCCCACAGCCCAGGG + Intronic
900264533 1:1750592-1750614 AGGGCGGGGCCCACAGCCCAGGG + Intergenic
900885260 1:5410559-5410581 GGAGAGACGCCCACCTCCCAAGG - Intergenic
901533366 1:9867305-9867327 AAGGGGAGGCCCCCACCCCAGGG + Intronic
902153049 1:14460441-14460463 AGAGAGAAGCCAACATCCCCAGG - Intergenic
902834846 1:19040412-19040434 AGAGCAAGGTCCACATCCCAGGG + Intergenic
903054270 1:20624524-20624546 GTGGAGAGGCCCACATAGCAAGG - Intergenic
903168315 1:21536723-21536745 AGGGGGAGGGTCACTTCCCAAGG + Intronic
903179929 1:21600054-21600076 GGGGACAGGCACACAGCCCAGGG + Intronic
903194755 1:21677206-21677228 TGGGAGAGGCCCCAAGCCCAGGG + Intergenic
903276456 1:22225000-22225022 ATGGAGAGGCCCACCTGGCAAGG + Intergenic
903286118 1:22277843-22277865 AGGGTGAGGCCGCCTTCCCAGGG - Intergenic
903581230 1:24372507-24372529 GTGGAGGTGCCCACATCCCAGGG + Intronic
903666410 1:25010251-25010273 ATGGAGAGGCCCACATGGCAAGG + Intergenic
904239330 1:29133976-29133998 AGGGAGAGTGCCACACCCGAGGG - Intergenic
906171492 1:43729604-43729626 AGGGAGAGTCACACATGCCTGGG - Intronic
906580484 1:46931248-46931270 AGGGAGAGGCCCAGCTGGCAGGG - Intronic
906831999 1:49042623-49042645 AGGTTGAGGGCCACATCCCAAGG + Intronic
907490475 1:54806033-54806055 AGGGCGAGGCCCACAGCTCCGGG + Intergenic
908231585 1:62110800-62110822 AGGGAGACTACCACATCCCTTGG - Intronic
908530440 1:65028812-65028834 AGGGTGAGGCCCAAATAACATGG + Intergenic
908661458 1:66440139-66440161 AGGCAGAGGACCACATCCTCAGG + Intergenic
910103951 1:83610464-83610486 AGAGAGAGGGCCACAACTCAAGG + Intergenic
912166563 1:107048391-107048413 TGGGAGAGGACCACATAGCAAGG + Intergenic
912331591 1:108825063-108825085 TTGGAGAGGCCCACATGTCAGGG + Intronic
912495733 1:110089957-110089979 CAGGAGAGGCCCATCTCCCAAGG - Intergenic
914901996 1:151716054-151716076 AGGGAGAGGCCCAAAGGCCAAGG + Exonic
915315051 1:155023801-155023823 AGGGAGAGGCACACGCCCCAGGG + Intronic
915648738 1:157292507-157292529 GTGGAGAGGCCCACATGGCAGGG + Intergenic
918213847 1:182375794-182375816 ATGAAGAGGCCCACATGGCAAGG + Intergenic
919943515 1:202304306-202304328 AGAGAGAGGGCCACAGCCCAGGG - Intronic
920364200 1:205439560-205439582 CCAGAGAGGCCCACATTCCAAGG + Intronic
922796663 1:228342914-228342936 AGGGAGAGGCCCCCAGCTCCTGG - Intronic
1062955719 10:1539045-1539067 ATGCAGAGACTCACATCCCAGGG - Intronic
1063921994 10:10942485-10942507 ATGGAAAGGCCCACATGGCAAGG - Intergenic
1063974166 10:11402029-11402051 AAGAAGTGGGCCACATCCCAGGG + Intergenic
1064366884 10:14716395-14716417 GTGGAGAGGCCCACATGGCAAGG - Intronic
1066220512 10:33334074-33334096 AGGAAAAGCCCCACAGCCCAAGG + Intronic
1068522759 10:58095374-58095396 AAGGAGAGGCCAACATTCCCTGG + Intergenic
1068760585 10:60704069-60704091 TGTGAGAAGCCCACATCACATGG + Intronic
1069495763 10:68901665-68901687 GAGGAGAGGCCCAAAGCCCAGGG - Intronic
1069580622 10:69563654-69563676 ATGGAGAGGCCAACATGGCAAGG + Intergenic
1069821353 10:71230579-71230601 GGGGGGAGGCCCACATACCCAGG - Intronic
1069945347 10:71981641-71981663 AGGGAGAAACGCCCATCCCAGGG + Intronic
1071214080 10:83378557-83378579 AGGTAGAGGCCCTCTTGCCAGGG - Intergenic
1071920428 10:90343510-90343532 ATGGAGAGGCTCACATGGCAAGG - Intergenic
1071976456 10:90960817-90960839 AGGGAGGGAGCTACATCCCAAGG - Intergenic
1072926625 10:99621538-99621560 AGGGAGAAGCCCTCATCGCCAGG - Intergenic
1073487182 10:103826979-103827001 AGGGAGAGACCCACAGGGCATGG + Intronic
1073737558 10:106367234-106367256 ATGGAGAGGGCCACATGGCAAGG - Intergenic
1073767646 10:106700770-106700792 AGGGAGAAGTCCATATCCAAAGG + Intronic
1075991490 10:126842499-126842521 AAGGTGAGGCCCAAATGCCAGGG + Intergenic
1076065294 10:127443539-127443561 AGGGAGAGCCCCACAAACCTGGG - Intronic
1076505703 10:130971369-130971391 CAGGAGGAGCCCACATCCCATGG + Intergenic
1076583750 10:131531896-131531918 AGGCAGAAGCACACACCCCATGG - Intergenic
1076835536 10:133019320-133019342 AGGCAGGTACCCACATCCCAAGG - Intergenic
1076844537 10:133062784-133062806 AGGGAGGGGCCCGCAACCCAGGG - Intergenic
1077195270 11:1276771-1276793 AAGGAGAGACGCACGTCCCAGGG + Exonic
1077240700 11:1508972-1508994 CGGGAGAACCCCACATTCCAAGG + Intergenic
1077301831 11:1850954-1850976 AGGGGGAGGCCCACAGGCCCTGG - Intergenic
1078549146 11:12268542-12268564 AGGGTGCGGCCCCCATGCCAAGG + Intergenic
1079122063 11:17693122-17693144 ATGGAGAAGCCCACATGGCAAGG + Intergenic
1079352434 11:19703282-19703304 AGGAAGAGGCCCAGTGCCCAGGG - Intronic
1080192025 11:29562383-29562405 AAGGAGAGGCCCACCTACCAAGG + Intergenic
1080651037 11:34222909-34222931 AGGGAAAGGCCCACCTTCCCAGG - Intronic
1082832636 11:57630435-57630457 TTGGAGAGGCCCACATTGCAAGG + Intergenic
1083110468 11:60401227-60401249 TCAGAGAGGCCCACATCCCCAGG - Intronic
1083173435 11:60935858-60935880 AGGGAGAGGGCCACCTCCTGTGG - Exonic
1083880438 11:65545820-65545842 AGGGACAGGTCCCCATCCCTTGG - Intronic
1084453990 11:69256861-69256883 AGGGAGAGGCCACCAGCACAGGG + Intergenic
1084456023 11:69268743-69268765 AGAAAGAGGCCCCCACCCCAGGG - Intergenic
1084974536 11:72789623-72789645 ACTGAGAGGTCCACATTCCAGGG + Intronic
1085049055 11:73370556-73370578 ACTTAGAGGCCCACATTCCAGGG + Intergenic
1085238478 11:75032887-75032909 AGGGAGAGGGCCACAGGCAAAGG + Intergenic
1086145565 11:83547524-83547546 AGGAAGAGGACCACAAGCCAAGG + Intronic
1088021509 11:105125312-105125334 ATGCAGTAGCCCACATCCCAAGG + Intergenic
1089067529 11:115673217-115673239 AGGGAAAGTACCATATCCCAGGG - Intergenic
1089344777 11:117784141-117784163 AGACAGAAGCTCACATCCCAGGG - Intronic
1089636218 11:119814081-119814103 AGAGAGAGGCCCACATAGTAAGG + Intergenic
1090361677 11:126177058-126177080 TCGGAGAGGCCCACATGGCAAGG - Intergenic
1092525879 12:9310125-9310147 AGGGTGAGGCTCCCATCCCGGGG - Intergenic
1093425762 12:19027336-19027358 AGGGAGAGATCCATTTCCCAGGG + Intergenic
1094540639 12:31360726-31360748 AGGGAAGTGCCCACATCGCAGGG - Intergenic
1095811497 12:46376669-46376691 ATGGAGAGGCCCACATGTCAAGG + Intergenic
1096016733 12:48282967-48282989 AGGGAGAGGCTCACATGTCAAGG - Intergenic
1098233824 12:68399080-68399102 AAAGAGAGGCCCACATGACAAGG + Intergenic
1098961089 12:76740188-76740210 TGGGAGTGGCCCAGATCTCAGGG + Intergenic
1099394026 12:82116178-82116200 TGGGAGTATCCCACATCCCATGG - Intergenic
1099583302 12:84481681-84481703 ATGGAGAGGCCTACATGGCATGG + Intergenic
1100041262 12:90320999-90321021 AGGGAGAGGTTCACATGGCACGG - Intergenic
1100086552 12:90917776-90917798 AGGGAGAGTCCCACAAACCTGGG - Intronic
1100458286 12:94774139-94774161 ATGGAGAGGCCCACATGGCAAGG - Intergenic
1101300305 12:103472817-103472839 AGGGAGAGGCCCTGTACCCATGG + Intronic
1101579724 12:106031941-106031963 AGGGAGGGGCCCAGCTGCCAAGG - Intergenic
1102185080 12:110941505-110941527 AGGGAGAGTGGCACATTCCACGG - Intergenic
1102240599 12:111322362-111322384 AGGGCCAGGCCCATGTCCCAGGG + Intronic
1102545715 12:113653830-113653852 ATGGAGAGGCCCACATGGCAAGG - Intergenic
1103001409 12:117387991-117388013 AGGGAGAGGCCCACGTGGCACGG + Intronic
1103184014 12:118940544-118940566 ATGGAGAGGTCCACATGGCAAGG - Intergenic
1104068575 12:125326076-125326098 AGGGAGAGGGGGACACCCCAGGG + Intronic
1104953565 12:132453286-132453308 AGGGAGGGGCACACAAGCCAAGG - Intergenic
1106272352 13:28166886-28166908 AGGGAGAGGCCCAGTTGCCCAGG - Intronic
1106758150 13:32842812-32842834 TTGGAGAGGCCCACATGGCAAGG + Intergenic
1106985812 13:35347910-35347932 TGAGAGAAGCCCACATCACATGG - Intronic
1108328697 13:49361799-49361821 AGAGAGGGGCACTCATCCCAGGG - Intronic
1108504245 13:51096359-51096381 ATGGAGAAGGCCACATCCCCAGG - Intergenic
1108721438 13:53136789-53136811 AGGGAGAGTCCCACCTGACAAGG - Intergenic
1110832905 13:80052422-80052444 TGGGAGAGGCCCACCTGGCAAGG + Intergenic
1111944416 13:94648630-94648652 TGGGAGAGGGCCACATAGCAAGG - Intergenic
1113609175 13:111631256-111631278 CGGGGCAGGCCCACACCCCAAGG + Intronic
1113906975 13:113823845-113823867 AGGGACAGGCCTGCGTCCCATGG - Intronic
1115494102 14:33985388-33985410 ATGGAGGGGCCCACATGGCAAGG - Intronic
1115645364 14:35365526-35365548 AGGGCCAGGCCCACCTCCCGTGG + Intergenic
1116341860 14:43733425-43733447 AGGGAGAGGCCCAGAAAGCAGGG + Intergenic
1118149927 14:63178703-63178725 AGTGCAAGGCCTACATCCCAGGG + Intergenic
1118321496 14:64755983-64756005 AGGGAGAGTCCCACAAACCTGGG + Intronic
1119185845 14:72641973-72641995 ATGGAAAGGCCCACATGGCAAGG + Intronic
1119750496 14:77074140-77074162 ATGGAGAGGTCCACATGGCAAGG - Intergenic
1119762478 14:77161235-77161257 AGGAAGAGGCTGGCATCCCATGG - Intronic
1120845997 14:89125690-89125712 AGTTAGATGCCCTCATCCCAAGG - Intronic
1121000694 14:90450273-90450295 AGGGAGAAGCACACATACCTGGG - Intergenic
1121074417 14:91055886-91055908 ATGGAGAGGCCCACATGGCAAGG + Intronic
1121494205 14:94380755-94380777 AGGGTGAACCCCACATCCCTGGG - Intronic
1121671520 14:95714125-95714147 AGGGTCGGCCCCACATCCCAGGG - Exonic
1122067889 14:99186153-99186175 AGGGAGAGGCTGACATCCTCGGG + Intronic
1122135295 14:99629172-99629194 GGGGAAAGGCCCACCTCACAGGG - Intergenic
1122982263 14:105197076-105197098 AGGGGCAGGGCCAGATCCCAGGG - Intergenic
1124454451 15:29827460-29827482 AGGGAGAGGATCCCATCCCCAGG - Intronic
1125484407 15:40102451-40102473 AGGAGGAGGCCCTTATCCCAAGG - Intronic
1125576236 15:40757447-40757469 AGGGTAAGGCCACCATCCCAAGG - Intergenic
1127072081 15:55296912-55296934 AGGGTTGGGCCCATATCCCAGGG + Intronic
1127389515 15:58494104-58494126 AGGGAGAGGCCCCCATGGCAAGG - Intronic
1127641577 15:60920605-60920627 AGGGAGAAGCCTACATACCATGG + Intronic
1128368749 15:67023951-67023973 AGGGAAAGGCCCAGTGCCCAAGG - Intergenic
1128794059 15:70451994-70452016 AGTGACAGTCCCACATCCGAGGG + Intergenic
1129017723 15:72483274-72483296 ATGGAGAGGCCCACATGGCAAGG - Intronic
1129602266 15:77007091-77007113 AGGGAGGAGCCCACAACCCAGGG - Intronic
1130016964 15:80195085-80195107 AGGAAGAGGCTCACACCCCCAGG - Intergenic
1130271673 15:82454105-82454127 ATGGAGAGGCCCACGTGACAAGG - Intergenic
1130285704 15:82552786-82552808 GGAGGGAGGCCCACAACCCAGGG - Intronic
1130464021 15:84181492-84181514 ATGGAGAGGCCCACGTGACAAGG - Intronic
1130474822 15:84255422-84255444 ATGGAGAGGCCCACGTGACAAGG - Intergenic
1130482238 15:84369478-84369500 ATGGAGAGGCCCACGTGACAAGG - Intergenic
1130488663 15:84413341-84413363 ATGGAGAGGCCCACGTGACAAGG + Intergenic
1130500246 15:84492049-84492071 ATGGAGAGGCCCACGTGACAAGG + Intergenic
1130507802 15:84562528-84562550 ATGGAGAGGCCCACATGGCAAGG + Intergenic
1130586317 15:85186124-85186146 ATGGAGAGGCCCACGTGACAAGG - Intergenic
1131743343 15:95418280-95418302 AGGCAGAGGACCACAGCCTATGG - Intergenic
1131833181 15:96367001-96367023 AGGGAGAGGTCCACAGCCCTAGG + Intergenic
1132428133 15:101737841-101737863 ATGGAGAGGCCCACGTGACAAGG + Intronic
1132473333 16:119092-119114 AGGGAGAGCCCCACCTGCCCAGG + Intronic
1132607910 16:801131-801153 AGTAAGAGGCTCACATCCCAGGG - Intergenic
1132858372 16:2057721-2057743 TAGGAGAAGCCTACATCCCAAGG - Intronic
1132986877 16:2771889-2771911 AGGGAGTGGGACCCATCCCAGGG + Intronic
1133174519 16:4003930-4003952 AGTGAGAGGTCCTCATCCTAAGG - Intronic
1133204610 16:4225850-4225872 AAGAAGAGGCCAACATCCTACGG + Intronic
1134098707 16:11436467-11436489 AGGGATAGGCTCACGTCCCTTGG - Intronic
1134378211 16:13699394-13699416 ATGGAGAGGCCCACACAGCAAGG + Intergenic
1135964699 16:27025919-27025941 GGGGAGCGACCCACATCCCCAGG - Intergenic
1136032917 16:27516445-27516467 AGGCAGAGCCGCAGATCCCATGG - Intronic
1136995901 16:35187924-35187946 AGGGGGAAGCCCAGAACCCAGGG - Intergenic
1137029181 16:35506393-35506415 AGGGAGAAGCCCCCTTGCCAGGG - Intergenic
1137394751 16:48109026-48109048 AGGGAGCGGCCTTCACCCCAAGG - Intronic
1137468946 16:48737289-48737311 ATGGAGAGGACCACATGGCATGG - Intergenic
1138108634 16:54305663-54305685 AGGCAGAGCCCCAGAACCCAGGG + Intergenic
1138219652 16:55239981-55240003 AGGGAGAGGCCTGCATGCCCTGG - Intergenic
1138767220 16:59618703-59618725 ATGGAGGGGGCCACATGCCAAGG - Intergenic
1139343599 16:66288104-66288126 GTGGAGAGGCCCACATGGCAGGG - Intergenic
1140193263 16:72836178-72836200 AGGGAGTGGCCCACCTCCATCGG - Intronic
1140793103 16:78410971-78410993 ATGAAGAGGCCCACATGGCAGGG - Intronic
1140950284 16:79810414-79810436 GGGCAGAGCCCCTCATCCCAAGG + Intergenic
1141488103 16:84354412-84354434 AGGCAGAGGGCCACCTCCAAAGG + Intergenic
1141818051 16:86426224-86426246 GGGGAGAGCCACACTTCCCAGGG - Intergenic
1142265637 16:89062945-89062967 AGGGACAGTCCCACAACCCCTGG + Intergenic
1142326256 16:89416869-89416891 AGGGAGCACCCCACACCCCAGGG - Intronic
1142613307 17:1121065-1121087 AGGGCCAGGCCCACAGACCACGG - Intronic
1143486699 17:7259188-7259210 AGGGATAGGGCCACCTCCCAAGG - Intronic
1143517918 17:7429271-7429293 GGGGACAGGCCCATATCCCTGGG - Intergenic
1143890483 17:10098617-10098639 AGGGATATGCCCACTTCCCATGG - Intronic
1144266701 17:13576374-13576396 ATGGAGAGGCCCACATGGCAAGG - Intronic
1144393879 17:14824508-14824530 ATGGAGAGGACCACATTGCAAGG + Intergenic
1145370298 17:22301880-22301902 CCGGAGAGGCCAGCATCCCAGGG - Intergenic
1146423498 17:32712771-32712793 AATGAGAGGCCCACATGACAAGG - Intronic
1146723141 17:35137350-35137372 TGGGAGAGGCTCTCATCACAGGG - Intronic
1147138795 17:38450117-38450139 AGGGAGACCCCCACAAACCAAGG - Intronic
1147959756 17:44159675-44159697 AGGGAAAGGCCCCCATCACGTGG - Intronic
1148326540 17:46786380-46786402 AGGAAGAGACCCACAGCCCTGGG - Intronic
1148536110 17:48440443-48440465 AGGGACAGTCTCACCTCCCAAGG - Intergenic
1148678068 17:49456595-49456617 GGAGAGAGGACCACATCCCAGGG - Intronic
1149428702 17:56579332-56579354 AGGGAGAGGCTCCCTTCCCTTGG - Intergenic
1150183879 17:63158988-63159010 ACGGAGACGCCCACATAGCAAGG - Intronic
1151129671 17:71883322-71883344 AGGAAGAGGCCAGCATCCAAAGG + Intergenic
1151176652 17:72294290-72294312 AGGGAGAGGCCTTCATTCCTTGG - Intergenic
1151320031 17:73347528-73347550 AGTGGGAGGCCCTCAGCCCACGG + Intronic
1151478428 17:74356353-74356375 AGGGAGGGTCCCACAAGCCAGGG - Intergenic
1151515317 17:74590559-74590581 AGGCAGAGCTCCACAACCCAAGG + Exonic
1151707036 17:75774604-75774626 AGGGAGATGCCCTGATCACAAGG - Intergenic
1151763696 17:76121680-76121702 AGGGAGAGGCCCAGGGGCCAGGG + Intergenic
1151969280 17:77449571-77449593 AGGGAGAGGCCCACGGGGCAGGG + Intronic
1152146371 17:78571177-78571199 AGAGGGAGGCCAACATCCTAGGG + Intronic
1154066282 18:11110386-11110408 CGGGGGAGGCCCAACTCCCAGGG - Intronic
1156367954 18:36446974-36446996 AGGGTGAGGCCAACAGCCCTTGG + Intronic
1157688659 18:49663570-49663592 AGGGAGAGGCCCTCTTCCTCAGG - Intergenic
1158940952 18:62405553-62405575 AGGCAGAGGTCCACAACCCCCGG - Intergenic
1159961828 18:74561093-74561115 AGGGAGAGACCCAAAACCCAGGG - Intronic
1160398497 18:78590177-78590199 AGGCAGAGTCTCCCATCCCATGG + Intergenic
1160980417 19:1814071-1814093 AGGGGGAGGCAGACATCACATGG + Intergenic
1162040968 19:7970962-7970984 AAGGTGAGGCTCCCATCCCAGGG - Intronic
1162154999 19:8671610-8671632 AGGAAGAGGAACACAGCCCAGGG - Intergenic
1165145814 19:33729331-33729353 ACGGAGAGGCCCACATGGCAAGG - Intronic
1165404684 19:35622405-35622427 AGGGACAGGTCCTCATCTCAAGG + Intronic
1165867598 19:38948532-38948554 AGTGAGAGGCCCCGATCCCTGGG - Intronic
1166323468 19:42034433-42034455 AGAGCAGGGCCCACATCCCAGGG - Intronic
1166984660 19:46652659-46652681 AGTGAGAGGCCCAAGTCCCTAGG - Exonic
1167031831 19:46967357-46967379 AGGGAGAGACCCCCTCCCCATGG - Intronic
1167695051 19:51010245-51010267 GGGAAGAGGCCCAAATCCCCAGG - Intergenic
925479006 2:4249633-4249655 AGGGTGAGGGCCACATCCATGGG - Intergenic
926472141 2:13273538-13273560 ATGGAGAGGGCCACATGACAAGG - Intergenic
926740836 2:16109478-16109500 AGGAAGAAGATCACATCCCAAGG - Intergenic
928390163 2:30903508-30903530 CTGGAGAGGCCCACATGGCAGGG + Intergenic
928391179 2:30912183-30912205 ACGGAGTTGGCCACATCCCAGGG + Intronic
929404480 2:41625928-41625950 GTGGAGAGGCCCACATGGCAAGG - Intergenic
929990668 2:46783644-46783666 ATGGAGAGAGCCCCATCCCATGG - Intergenic
930086834 2:47503647-47503669 AGAGAGAGGCCCGCAGCCCCGGG - Intronic
930169064 2:48232504-48232526 ACGGAGAGCCCCACATGGCAAGG + Intergenic
931258950 2:60600006-60600028 AGAAGGAGGCCCACATCACAAGG + Intergenic
931441373 2:62293090-62293112 TGGGGGAAGCCCACAACCCAGGG + Intergenic
931489233 2:62725994-62726016 AGGGAGAGGCCAGCAGACCAAGG + Intronic
932007468 2:67940993-67941015 ACGGAGAGGCCCACATAGCAAGG + Intergenic
932362125 2:71118011-71118033 AGGGAGTGGCCCAGCTCACATGG - Intronic
932454897 2:71843342-71843364 AGGAAGGGGCCCAGAACCCAAGG - Intergenic
932573674 2:72951241-72951263 ACGGAGAGGGGCACATCCCGAGG - Intronic
933680436 2:85095148-85095170 AGGAAGAGTCCCACATGGCAAGG - Intergenic
934099643 2:88640915-88640937 TGGGAGAGGCCAGCATACCAAGG - Intergenic
937328038 2:121003944-121003966 AGGGGGAAGCCCATATCCCATGG - Intergenic
937968013 2:127528789-127528811 AGCGATAGGCCCACAGCCTAGGG - Intergenic
940313232 2:152301351-152301373 AGGGCAAGACCCACATCCCAGGG + Intergenic
942249160 2:174033059-174033081 AGGGTAGGGACCACATCCCAGGG - Intergenic
946157625 2:217817676-217817698 GGGGAGAGGCCCACCTGGCATGG + Exonic
946429074 2:219615038-219615060 ATGGAGGGGCCCAGATCCCTGGG - Intronic
946878667 2:224156231-224156253 AGGGAGGGGCCCAAATCCTCCGG - Intergenic
947751793 2:232536434-232536456 ATGGAGAGGCCCACATGGCAAGG + Intronic
947762318 2:232611725-232611747 AGTGAGAGGCCCCCGCCCCAGGG + Intronic
947968540 2:234302500-234302522 AGGGAGAGGTGCACACACCAGGG + Intergenic
948671860 2:239574084-239574106 AGGGTGGGGCCCACACACCAGGG - Intergenic
948679880 2:239626604-239626626 AGGGGGGGGTCCACACCCCAGGG - Intergenic
949027893 2:241774848-241774870 AGGGACAGGTCCACATGCCCAGG - Intergenic
1169124715 20:3119210-3119232 ATGGAGAGGCCCACAAGGCAAGG + Intronic
1169591831 20:7151836-7151858 AGGGAGAGGGCAACACCCCGTGG - Intergenic
1170153031 20:13245297-13245319 ACGGAGAGGCCCACATGGCAAGG - Intronic
1170842601 20:19936098-19936120 CGGGAGAGAGCAACATCCCAGGG + Intronic
1171066296 20:22018620-22018642 GGGAAGAGGCCCACATCCCATGG + Intergenic
1171147430 20:22797639-22797661 AGAGGGAGGTCCATATCCCAGGG - Intergenic
1172387923 20:34547064-34547086 AGGGAGCGGCCCAGATGGCAGGG + Intronic
1172699789 20:36845960-36845982 AGGGAGAGGCCCAGCTCCACTGG + Intronic
1173194870 20:40905889-40905911 ATGGAGAGGGCCACATGGCAAGG + Intergenic
1173298395 20:41779461-41779483 AGGTAGAGGCCAACTACCCAGGG - Intergenic
1173840872 20:46156209-46156231 ATGGAGAGGCCCACGTGGCAAGG + Intergenic
1174130401 20:48340195-48340217 AGGGAGCTGCCCAGAGCCCAGGG - Intergenic
1175994778 20:62807189-62807211 AGGGTCAGGGCCACACCCCAGGG + Intronic
1176104045 20:63377313-63377335 AGGGAAAGGCTTCCATCCCACGG + Intronic
1177243537 21:18492678-18492700 AGGAAGAGGCCCACAGCCAGTGG - Intergenic
1177474070 21:21595382-21595404 ATGGAGAGGCCCACAAGGCAAGG + Intergenic
1177861903 21:26464156-26464178 ACAGAGAGGCCCATATGCCAAGG + Intergenic
1178049285 21:28730652-28730674 ATGGAGAGGTCCACATAGCAAGG - Intergenic
1178622877 21:34191970-34191992 AGGGAGAGACCCACAGCCAATGG - Intergenic
1179815133 21:43900755-43900777 AGGGAGAGACTCACCACCCAAGG + Intronic
1179926674 21:44538728-44538750 CTGGAGAGCCCCACAGCCCAGGG + Intronic
1179932387 21:44579205-44579227 CTGGAGAGCCCCACAGCCCAGGG + Intronic
1179937233 21:44613436-44613458 CTGGAGAGCCCCACAGCCCAGGG - Intronic
1180232953 21:46438432-46438454 AAGGTGACGCCCACATCCCCAGG - Intronic
1181174658 22:21028765-21028787 ATGGGAAGGCCCACAGCCCAAGG - Exonic
1181381320 22:22507093-22507115 ATGGAGAGGCCCACAGAGCAAGG + Intronic
1181829908 22:25551926-25551948 AGGGAGAGGAACACACACCAGGG - Intergenic
1181980687 22:26763841-26763863 GGGGAGAGGACCACAGCGCAGGG + Intergenic
1182447278 22:30397200-30397222 AGGGCGAGGGCCACAGCCCGAGG - Intronic
1182488263 22:30652691-30652713 ATGGAGAAGCCCACATGGCAAGG - Intronic
1182618490 22:31604730-31604752 AGGAAGAGGCCAACAGCCCCTGG - Intronic
1182866537 22:33609293-33609315 TGGGAATGGCCCACTTCCCAGGG + Intronic
1183397830 22:37582988-37583010 ATGGAGAGGCCCATGTGCCAAGG + Intergenic
1183627845 22:39015483-39015505 TGGGGGAGGCCCAGAGCCCAGGG + Intronic
1183630429 22:39029264-39029286 TGGGAGAGGCCCAGACTCCAGGG + Intronic
1184234834 22:43177629-43177651 ATGGAGAGGCCCACAAGGCAGGG + Intronic
1184383107 22:44158692-44158714 AGGGAGAGGCCCACGCACGAGGG - Intronic
1184761480 22:46547219-46547241 AAAGAGAGTCCCACATTCCAGGG + Intergenic
1185108124 22:48885635-48885657 AGAGAGAGGCCCCCACCACAGGG - Intergenic
1185227316 22:49660433-49660455 AGGAAGAGGCCCCCACACCATGG + Intergenic
949970369 3:9398067-9398089 AGGGCCAGGCCCACGACCCAAGG - Intronic
950153665 3:10707414-10707436 AGGGAGAAGCCCCCAGCCTAGGG + Intronic
950189356 3:10965991-10966013 AGAGAGTGGCCCAGAGCCCATGG - Intergenic
951530185 3:23691677-23691699 ATGGAGAGGCCCACGTGTCAAGG - Intergenic
951561964 3:23976568-23976590 GTGGAGAGGCCCACATGGCAAGG - Intronic
952206880 3:31189186-31189208 GGGGAGAGGAACACATCCCAAGG - Intergenic
954337859 3:49930064-49930086 ACGGAGAGGCCCAGAGTCCAGGG - Exonic
955700818 3:61680327-61680349 AGGGAGAGGGCCTCATCTCAGGG + Intronic
956021868 3:64941649-64941671 ATGGAGAGGCCCACATAGCAAGG - Intergenic
956054858 3:65288059-65288081 AGACAGAAGCCCACACCCCATGG + Intergenic
956747628 3:72322229-72322251 AGGCTCAGGCCCACAACCCATGG + Intergenic
957000934 3:74883919-74883941 ATGGAGAGACCCACATGGCAAGG - Intergenic
959585644 3:108022698-108022720 CAGGAGAGGCCCCCACCCCAAGG - Intergenic
959685947 3:109146617-109146639 AGGGAGAAGACCACATGACAAGG - Intergenic
959944824 3:112115347-112115369 AGGGAGAGGCCCAGGGCCCTGGG + Intronic
960058024 3:113289835-113289857 ATGGAGAGGCCCACATGGCGAGG + Exonic
960794289 3:121468309-121468331 AGGCAAAGGCCTACTTCCCATGG - Exonic
961045799 3:123707128-123707150 ACGGAGAGGTCCACAACGCAAGG + Intronic
962204286 3:133422459-133422481 AGGGAGAGGGCTTCATCTCAGGG - Intronic
962280716 3:134049731-134049753 AAGGAGAGGACCAGAGCCCAGGG - Intronic
962723926 3:138203503-138203525 GTGGAGAGGCCCACATGGCATGG - Intronic
964323922 3:155526551-155526573 ATGGAGAGACCCACATGGCAGGG + Intronic
965672456 3:171160538-171160560 GAGGGCAGGCCCACATCCCATGG - Intronic
966912235 3:184566079-184566101 TGGGAGAGGCCCCCTGCCCAAGG + Intronic
966983794 3:185161618-185161640 AGGGAAAGGCCCACATGGCAAGG + Intergenic
967420087 3:189262901-189262923 ACGGAAAGGCCCACATGGCAAGG - Intronic
969423327 4:7109665-7109687 AGGGAGAGGATCCCCTCCCAGGG - Intergenic
969485017 4:7467359-7467381 AGGGTGAGCTCCTCATCCCAGGG - Intronic
969707565 4:8820225-8820247 AGGGAGAGGTCCCCATCGCCGGG + Intergenic
971054123 4:22893747-22893769 CAGGAGAGGCCCACATGACATGG - Intergenic
974057171 4:56995789-56995811 ACGCAGAGGCCCACATGGCAAGG - Intronic
975620953 4:76295935-76295957 ATGGAGAGGCCCACATAGCAAGG + Intronic
977836858 4:101655360-101655382 ATGGAGAGGCTCACATAGCAAGG - Intronic
983934405 4:173490941-173490963 AGGGCAGGTCCCACATCCCAGGG - Intergenic
984862364 4:184252386-184252408 AGGGAGAGGATCACAAGCCAAGG + Intergenic
986165480 5:5268718-5268740 GGGCATAGGCTCACATCCCATGG - Intronic
986859847 5:11914125-11914147 ATGGAGAGACCCACATGGCAAGG + Intergenic
987476958 5:18402204-18402226 AGGGAGAGCCCAACCTCACAAGG - Intergenic
988670183 5:33372794-33372816 AGGGAGAGGCACATCGCCCAGGG - Intergenic
990801476 5:59608956-59608978 ATAGAGAGGCCCACATGGCAAGG + Intronic
991584825 5:68191217-68191239 AGGGAGAGGTCCATTCCCCATGG - Intronic
993918659 5:93772777-93772799 GTGGAGAGGCCCACATGGCAAGG - Intronic
994093387 5:95827578-95827600 ATGGAGAGGCACCCATCCCATGG - Intergenic
994336777 5:98576441-98576463 AGGGAGCGGCCCGCATCCGTGGG + Intergenic
995495878 5:112742612-112742634 ATGGAGAGGCCCACGTGACAAGG - Intronic
995555392 5:113323067-113323089 ATGGAGAGGCCCACATCATGAGG + Intronic
996047685 5:118893763-118893785 ATGGAGAGGACCACAAGCCAAGG + Intronic
996535739 5:124575511-124575533 AGGGAGAGGACCCCAGCCCTAGG + Intergenic
997276541 5:132597557-132597579 CTGGAGAGGCCCATATGCCAAGG + Intronic
997361624 5:133298938-133298960 AGGGAGTAGCCCTCATCCCAGGG - Intronic
1000375338 5:160575895-160575917 AGGGAGAGGTGCAGATTCCATGG - Intronic
1001559276 5:172658818-172658840 TGGGAGAGGCAGACCTCCCAGGG - Intronic
1001770431 5:174292085-174292107 AGGAAGAGGCCCACATGTCAAGG - Intergenic
1001962143 5:175885994-175886016 TGGGAGAGGCCCACCTGGCAAGG - Intergenic
1002518079 5:179774153-179774175 ATGGACATGCCCACATTCCACGG + Exonic
1003241620 6:4350271-4350293 AGGAAGAGCCCCAGATCTCATGG - Intergenic
1004015654 6:11729498-11729520 AGGGAAAGGCCCTCCTCTCAGGG - Intronic
1004218985 6:13729287-13729309 AGGGAGAGGCCCACATGGCAAGG - Intergenic
1004925492 6:20411767-20411789 AGGGAGAGGCCCAAGCCCCTGGG - Intronic
1006245030 6:32725718-32725740 AATCAGAGTCCCACATCCCATGG + Intergenic
1006743798 6:36327204-36327226 AGGGAAAGCACCACATCCCAGGG + Intronic
1006914476 6:37585485-37585507 TGGGAGGAGCCCACATCCCAGGG - Intergenic
1007827027 6:44608177-44608199 TGGGTGGGGCCCACATCCCTGGG + Intergenic
1008049416 6:46884816-46884838 ATGGAGAGGTCCACATGGCAAGG + Intronic
1008438440 6:51503920-51503942 ATGGAGAAGCCCACATAGCAAGG + Intergenic
1008687989 6:53945738-53945760 AGGGAGAGGCCAACAGACCACGG - Intronic
1009897510 6:69771327-69771349 ATGGAGAGGCCCACATAGCAAGG - Intronic
1014538804 6:122649540-122649562 AGGAAGTGGCCCAAATCCCATGG - Intronic
1014748182 6:125224456-125224478 AGAGAGAGGCCCAGAGCCTAAGG - Intronic
1017755369 6:157525120-157525142 ATGGAGAGGCTCACATGGCAAGG - Intronic
1017823964 6:158068273-158068295 AGTGAGAGGCCCACCTCCCCAGG - Intronic
1018481848 6:164199060-164199082 AGGGAGAGACGCACAGACCACGG + Intergenic
1018975281 6:168560495-168560517 AGTGAGAGCCTCACATCTCAGGG - Intronic
1019340716 7:507591-507613 GGGGAGAGGCTCTCAGCCCATGG - Intronic
1021613153 7:22476977-22476999 GGGGAGAGGGCCACATAGCAAGG - Intronic
1021645538 7:22786090-22786112 ATGGAGAGGTCCACATGGCAAGG + Intergenic
1022304974 7:29138592-29138614 AGAGAGAGACCCAGATCCCTGGG + Intronic
1022782506 7:33600825-33600847 AGGCAGCAGCCCACAGCCCAAGG - Intronic
1023658617 7:42451038-42451060 ATGGAGAGGACCACATGGCAAGG + Intergenic
1028821252 7:95214413-95214435 AGGGAGAGGCCCACATCCCAAGG - Intronic
1028903652 7:96129037-96129059 ATGGAGAGGCCCACATGACAAGG + Intronic
1030026262 7:105327639-105327661 AGGGTGAGGCCCACATGTCCTGG + Intronic
1030093230 7:105876187-105876209 AGGGAGAGGCCCGGCTGCCAGGG - Intronic
1030357351 7:108557108-108557130 TGGGACAGGCCCACAGCCCTGGG - Intronic
1031060148 7:117042010-117042032 AGAGAGAGGGCCACAAGCCAAGG + Intronic
1033302228 7:140196726-140196748 GTGGAGAGGCCCACATGGCAAGG + Intergenic
1035060625 7:156066734-156066756 AGGGAGCCACCAACATCCCACGG + Intergenic
1035089021 7:156289931-156289953 AGGGAAAGGCCCACGTGACAAGG - Intergenic
1035109089 7:156465336-156465358 GGGGAGAGGCCCACATGTCGGGG - Intergenic
1035336324 7:158129651-158129673 AGGGAGACGTCCACAGCACAGGG + Intronic
1035788239 8:2279389-2279411 AGAGAGAGGATCAGATCCCACGG - Intergenic
1035804567 8:2442316-2442338 AGAGAGAGGATCAGATCCCACGG + Intergenic
1036504257 8:9341035-9341057 AGGCAGAGACCCTCATCTCAAGG + Intergenic
1036939501 8:13037941-13037963 AGGGAGAGGTCCACATGGTAAGG - Intergenic
1037884396 8:22588793-22588815 GGGCAGAGGCCCTCTTCCCAAGG - Intronic
1037967505 8:23145776-23145798 AGGGAGAGGCAAGCATCCCCAGG + Exonic
1038682015 8:29677471-29677493 ATAGAGAGGCCCACATGACAAGG - Intergenic
1038803304 8:30768698-30768720 ATGGAGAGGCCCACACAGCAAGG + Intergenic
1039580214 8:38659676-38659698 ATGGAGAGGCCCACATGGCATGG + Intergenic
1039600651 8:38834290-38834312 AGGGAAAGGCCCACGTGGCAAGG - Intronic
1039848790 8:41344692-41344714 AGGAAGAGGCCAAAATCCTAAGG - Intergenic
1040372220 8:46788235-46788257 TGGGAGAGGCCAACAGACCAAGG + Intergenic
1041925304 8:63230105-63230127 GTGGAGAGGCCCACATGGCAAGG - Intergenic
1042289115 8:67149124-67149146 ATGGAGAGGCCCATATGACAAGG - Intronic
1042502984 8:69529731-69529753 ATGGAGAGGTCCACATGGCAAGG - Intronic
1043528180 8:81119334-81119356 AGGGAGAGGCAGAGATCCAATGG + Intergenic
1049332118 8:142060107-142060129 AGGCAGAGGGCCCCTTCCCATGG + Intergenic
1049347889 8:142148417-142148439 AGTGAGAGGCCCACAGGCCCAGG - Intergenic
1050506975 9:6358634-6358656 AGGGTGAGGTCTACATGCCAAGG + Intergenic
1051500403 9:17770733-17770755 AAGGAGAGGACCACATGTCAAGG + Intronic
1051823161 9:21191873-21191895 AGTGACAGGCCCACCTTCCATGG + Intergenic
1052991683 9:34522430-34522452 AGGCACAGGCACACATCCAACGG - Intronic
1053314137 9:37037513-37037535 AGGGGGAGGCCGACATCGCCAGG + Intergenic
1054956904 9:70921775-70921797 ATAGAGAGGCCCACATGTCAGGG + Intronic
1056756163 9:89383248-89383270 AGAGTGAGCCCCACCTCCCAGGG - Intronic
1057508951 9:95661951-95661973 ATGGAGAGGCCCACATGGCAAGG - Intergenic
1059340604 9:113595438-113595460 AGGGCTGGGGCCACATCCCAGGG + Intronic
1060247303 9:121957534-121957556 AGGCAGGGGCCCACTTGCCAGGG - Intronic
1061796521 9:133088597-133088619 TGGGAGAGGCCCACATTGCCGGG - Intergenic
1062460677 9:136661396-136661418 AGGGTAAGGGCCAGATCCCAGGG + Intronic
1186498625 X:10032540-10032562 AGAGAGAGGACCAAATCGCAGGG - Intronic
1186579305 X:10800226-10800248 TTGGAGAGGCCCACATGGCAAGG + Intronic
1187965969 X:24612093-24612115 ATGGAGAGGGCCACATGGCAAGG + Intronic
1189108977 X:38267257-38267279 AGGGAGAGGGCCATGTGCCAGGG - Intronic
1189396273 X:40625469-40625491 ATGGAGAGGCCCAGATGACAAGG - Intergenic
1189481839 X:41398016-41398038 TGGGAGGGGCCCACATGGCAAGG - Intergenic
1189703281 X:43733758-43733780 AGGAGCAGACCCACATCCCAGGG + Intronic
1192317985 X:70066879-70066901 GGGGAGAGGCCCTCATTCCCAGG - Intergenic
1193250742 X:79288532-79288554 AGGGGGAGGCCAACAAACCAAGG - Intergenic
1196352470 X:114747739-114747761 ATAGAGAGGCCCACATGGCAAGG + Intronic
1196769601 X:119280751-119280773 ATGGAGAGACCCACATGGCAAGG + Intergenic
1197665042 X:129214246-129214268 AGGGAGAGGCCCACATGGCAAGG + Intergenic
1200133224 X:153862607-153862629 AGGGAGGGGCCTGGATCCCAAGG + Exonic
1202371191 Y:24197145-24197167 ATGGAGAGGCCCACATGACAAGG + Intergenic
1202376164 Y:24239454-24239476 ATGGAGAGGCCCACATGACAAGG + Intergenic
1202494616 Y:25430664-25430686 ATGGAGAGGCCCACATGACAAGG - Intergenic
1202499593 Y:25472972-25472994 ATGGAGAGGCCCACATGACAAGG - Intergenic