ID: 1028821253

View in Genome Browser
Species Human (GRCh38)
Location 7:95214426-95214448
Sequence GCCTCTCCCTGCTCATAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028821252_1028821253 -10 Left 1028821252 7:95214413-95214435 CCTTGGGATGTGGGCCTCTCCCT 0: 1
1: 0
2: 3
3: 55
4: 366
Right 1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG No data
1028821246_1028821253 21 Left 1028821246 7:95214382-95214404 CCTCACTGGCTGTTGGCCAGAAA 0: 1
1: 3
2: 22
3: 73
4: 302
Right 1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG No data
1028821244_1028821253 29 Left 1028821244 7:95214374-95214396 CCTCAGGTCCTCACTGGCTGTTG 0: 2
1: 19
2: 85
3: 170
4: 483
Right 1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG No data
1028821249_1028821253 5 Left 1028821249 7:95214398-95214420 CCAGAAACATCAGCTCCTTGGGA 0: 1
1: 0
2: 3
3: 282
4: 8664
Right 1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028821253 Original CRISPR GCCTCTCCCTGCTCATAAGA TGG Intronic
No off target data available for this crispr