ID: 1028824259

View in Genome Browser
Species Human (GRCh38)
Location 7:95251456-95251478
Sequence ACCCACATTGGGTAATTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028824259_1028824262 12 Left 1028824259 7:95251456-95251478 CCACTAAATTACCCAATGTGGGT 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1028824262 7:95251491-95251513 CTTTCCTATCTAAATATGTATGG No data
1028824259_1028824263 13 Left 1028824259 7:95251456-95251478 CCACTAAATTACCCAATGTGGGT 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1028824263 7:95251492-95251514 TTTCCTATCTAAATATGTATGGG 0: 1
1: 0
2: 0
3: 35
4: 291
1028824259_1028824265 28 Left 1028824259 7:95251456-95251478 CCACTAAATTACCCAATGTGGGT 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1028824265 7:95251507-95251529 TGTATGGGTGTTCTAGAATCAGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028824259 Original CRISPR ACCCACATTGGGTAATTTAG TGG (reversed) Intronic
904487878 1:30839794-30839816 ACACACATTGGTTAATTCAGTGG - Intergenic
908770118 1:67588261-67588283 ACCCCCATAGGGTAATTGAGAGG - Intergenic
909236047 1:73153620-73153642 CCCAAGATTGGGTAATTTAAAGG + Intergenic
916704244 1:167331489-167331511 ACCCACATTAACTTATTTAGTGG - Intronic
916781175 1:168031416-168031438 TCCCACATTGCCTAACTTAGGGG - Intronic
919329328 1:196149327-196149349 ACCCTCAATGTGTCATTTAGAGG + Intergenic
919865935 1:201782862-201782884 GCCCACATTGGGTACCTGAGAGG - Exonic
919869751 1:201811381-201811403 CCCAACTTTGGGGAATTTAGGGG + Intronic
1063411766 10:5841730-5841752 AGTCACATTTGGTGATTTAGGGG - Intronic
1064799610 10:19053533-19053555 ACCCACATTTCATCATTTAGTGG - Intronic
1072311350 10:94158506-94158528 ACCCACATTGGGAAATTTCCAGG - Intronic
1072554648 10:96505534-96505556 ACCCACATAGGGTTATTATGAGG - Intronic
1075675130 10:124290939-124290961 AGACACAGTGGGTAATTTGGGGG - Intergenic
1079591195 11:22185075-22185097 AGCCACAGTGGGTAATTTTGGGG - Intergenic
1087908231 11:103724264-103724286 CCCCACCATGGGTACTTTAGTGG + Intergenic
1090450116 11:126798632-126798654 GGCCACAGTGGGAAATTTAGAGG - Intronic
1098553981 12:71797780-71797802 ACCCAGATATGGGAATTTAGTGG + Exonic
1101342372 12:103854350-103854372 AGTCACATTGGATAATCTAGGGG + Intergenic
1102843383 12:116150808-116150830 ACCCACATATGGTACTTCAGGGG + Intronic
1105352647 13:19629787-19629809 AGTCACAATGGGTAATTTAATGG + Intergenic
1107487393 13:40842298-40842320 ACACACACTGGATAATGTAGAGG + Intergenic
1108388067 13:49919890-49919912 ACCCTCCTTGGGTTATTTTGAGG - Intronic
1110100883 13:71599857-71599879 ACACACATAAGATAATTTAGAGG + Intronic
1114171506 14:20277524-20277546 AACCACAATGGCAAATTTAGGGG - Intronic
1115046071 14:28995511-28995533 ATCCACATGGGAGAATTTAGTGG - Intergenic
1119095735 14:71829065-71829087 ACACACTTTGGGTATTTTAAGGG + Intergenic
1119316583 14:73701149-73701171 TCCCATATTGGGCAGTTTAGAGG + Exonic
1124924769 15:34060555-34060577 GCCCACATGGGGTATTTTAAGGG + Intronic
1127604491 15:60572652-60572674 AACCACATTGGATTATTTTGAGG - Intronic
1128463890 15:67892232-67892254 ACGCACACTGGGAAATATAGTGG - Intergenic
1133603437 16:7363038-7363060 CCCCACACTGGGTGATTTACAGG - Intronic
1136087463 16:27895811-27895833 ACCCTCAGTGGATACTTTAGTGG + Intronic
1140137062 16:72216096-72216118 GCCCACATGGTGTACTTTAGGGG - Intergenic
1147485293 17:40806835-40806857 CCCCACAGCGGGTAATTTAGGGG - Intergenic
1155488008 18:26368080-26368102 TCTCACATAGGGTATTTTAGAGG - Intronic
1155932544 18:31722860-31722882 ACCCAAATTGAGTAATAAAGAGG - Intergenic
1156576713 18:38325441-38325463 ACCCATATTTGTTAATTTATTGG - Intergenic
1157105284 18:44768873-44768895 ACCCACAGTGGGTGATAGAGTGG + Intronic
1161364951 19:3873264-3873286 AGCCACATTTGGTGATTTAGCGG + Intergenic
928254571 2:29711041-29711063 ATCCACCTTGAGTAATTGAGTGG - Intronic
929646247 2:43631566-43631588 ACCCACAAAGGGTAATTAAATGG - Intergenic
930273063 2:49279044-49279066 ACCCACATTGTGTACTATACAGG - Intergenic
931659838 2:64549088-64549110 AACCACATAGTTTAATTTAGAGG - Intronic
938218617 2:129545745-129545767 TCCAACATTGGGCACTTTAGTGG - Intergenic
938689863 2:133777500-133777522 ACCCAGAGTGGGTTATTTTGTGG - Intergenic
939658187 2:144853405-144853427 ACACACTTTTGGTATTTTAGAGG - Intergenic
942365928 2:175227599-175227621 CCCCACACTAGGTTATTTAGAGG - Intergenic
944902839 2:204233273-204233295 ATCCACAGTGGGTACTTTAAAGG - Intergenic
945284013 2:208064456-208064478 ACCCAAATAGAATAATTTAGAGG + Intergenic
1169995918 20:11556475-11556497 AACCACATTGAGTAATTTGGAGG - Intergenic
1171074135 20:22104859-22104881 AGCCACATTGTGTTATTTTGTGG + Intergenic
1175278977 20:57789948-57789970 ACACAAATTGTGTAATTTTGAGG + Intergenic
1177043451 21:16141567-16141589 ACACACATTGGGTCCTTTGGAGG - Intergenic
1177140187 21:17350168-17350190 ACCTAGATTGGGAAATTTACCGG + Intergenic
1181920014 22:26313254-26313276 AACCTCATTGGGTTATTTTGAGG - Intronic
949771235 3:7580580-7580602 ACCTAAATTGTGTAATTCAGAGG + Intronic
952571546 3:34723622-34723644 ACCACCAGTGGGTAATTCAGAGG + Intergenic
955680815 3:61499699-61499721 ACACACATTGGGGTCTTTAGAGG - Intergenic
955812523 3:62806064-62806086 GCCCAGACTGGGTAATTGAGGGG - Intronic
956698289 3:71937091-71937113 ACTCACATTGGCTACTTGAGTGG - Intergenic
957472314 3:80674240-80674262 TCTCACACTGGGTAATTTTGGGG - Intergenic
958697142 3:97542253-97542275 ACACACACTGGGTACTGTAGTGG - Intronic
959917423 3:111831544-111831566 TCCCACATGGGGTATTATAGTGG - Intronic
960476267 3:118132843-118132865 AACCTCATAGGGTAATTTTGAGG - Intergenic
960787977 3:121395743-121395765 ACTCACAATGAGTAATTTAATGG - Intronic
971099289 4:23445295-23445317 ACCCAAATTGGGTAATTTAAAGG - Intergenic
971903887 4:32700195-32700217 ACCCACACTCGCTAATTTATAGG - Intergenic
973507841 4:51418795-51418817 ACATACTTTGGGTAATTTGGTGG - Intergenic
977793999 4:101140888-101140910 ACCCACATAAAGTAAATTAGTGG + Intronic
979958364 4:126984367-126984389 GACCACATTGGGAAATTTGGGGG - Intergenic
984163889 4:176285479-176285501 AGCCACATGGGTTAATTTTGGGG - Intergenic
985944740 5:3170139-3170161 ACCCACATTTGGTAACTTATGGG + Intergenic
987186464 5:15425441-15425463 ACCCGCATTGGGTAAAATCGTGG + Intergenic
987617400 5:20294199-20294221 AACTACTTTGGGTAATTAAGAGG - Intronic
988203293 5:28098048-28098070 ACACACATTGTGAAGTTTAGAGG - Intergenic
995410943 5:111856315-111856337 ACACACATTGGGTCCTTTAGAGG - Intronic
999230411 5:150058529-150058551 TCCCAGAGTGGGTAATTTCGAGG - Intronic
999852811 5:155561033-155561055 ACCCACTTTGTGTGATTTCGGGG - Intergenic
1001199218 5:169700646-169700668 ACACACATTTGGAAATGTAGTGG - Intronic
1009448773 6:63776496-63776518 ACTGGCATTGAGTAATTTAGAGG + Intronic
1009553940 6:65137605-65137627 ACTCACATGAGCTAATTTAGTGG - Intronic
1010801238 6:80178048-80178070 AACCACATTGGGTAAGATAAGGG - Intronic
1012292287 6:97471682-97471704 ACCCACAGTGGTTTATCTAGTGG + Intergenic
1013677664 6:112484229-112484251 ACACACACTGGGAAATTCAGAGG - Intergenic
1013771278 6:113630968-113630990 ACACCCAGTGGGAAATTTAGAGG - Intergenic
1014493309 6:122089330-122089352 ACCTATATTGGGTGATTTATTGG + Intergenic
1018582299 6:165317588-165317610 ACCGACATTGGGTGTTTTGGGGG + Intergenic
1020948568 7:14647189-14647211 TACCACACTGGGTAATCTAGAGG + Intronic
1021066963 7:16187708-16187730 ACTCAAATTTGGTAATTTTGAGG + Intronic
1025102706 7:56149492-56149514 AGTCACAATGGGTAATTTAATGG + Intergenic
1026031833 7:66800949-66800971 ACCCACACTGTGTAACTTAACGG - Intronic
1026295873 7:69052069-69052091 GTCCACATGGGGTAATTGAGAGG - Intergenic
1027753256 7:82178811-82178833 ACGCACATTTAGTGATTTAGAGG - Intronic
1028092060 7:86715150-86715172 ACCCACATTAGGAAATGGAGTGG + Intronic
1028824259 7:95251456-95251478 ACCCACATTGGGTAATTTAGTGG - Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1032540054 7:132695315-132695337 TCCCACAATGGTTAATTTGGTGG + Intronic
1035861736 8:3036412-3036434 ACCCACATTGAGTACGATAGGGG - Intronic
1036744146 8:11392015-11392037 ACCCACATTTAGTTATTCAGGGG - Intronic
1039785752 8:40832949-40832971 ACCCATATTTGGTACTTTGGTGG + Intronic
1043311071 8:78859775-78859797 TCCCAAATTGGGGAATTTATTGG - Intergenic
1045162250 8:99561227-99561249 ATCCAGATTGGTGAATTTAGAGG - Intronic
1053166847 9:35850905-35850927 AACAGTATTGGGTAATTTAGTGG + Intronic
1055521459 9:77085207-77085229 ATCCAAATTGGTTAATATAGTGG + Intergenic
1057216934 9:93234344-93234366 CCCCACTTTGGGACATTTAGGGG + Intronic
1059303366 9:113333769-113333791 ACCTACATTGTCTCATTTAGTGG - Intronic
1185830031 X:3292715-3292737 ACTGACATAGGATAATTTAGGGG - Intergenic
1187996142 X:24928964-24928986 ACCCACATGGAGCAATTTATCGG - Intronic
1195478131 X:105310830-105310852 GCTCACATTGTGTAATTTATTGG + Intronic
1197553477 X:127924745-127924767 ACACACATTGGGTAAATAAAGGG + Intergenic
1198122366 X:133606795-133606817 TCCCACATTGTGTAATTATGGGG + Intronic