ID: 1028832134

View in Genome Browser
Species Human (GRCh38)
Location 7:95339894-95339916
Sequence TATCCATTTCCTACAGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028832134_1028832137 15 Left 1028832134 7:95339894-95339916 CCTATACCTGTAGGAAATGGATA No data
Right 1028832137 7:95339932-95339954 CTTTTCAAGACCCACTTCAGAGG No data
1028832134_1028832138 18 Left 1028832134 7:95339894-95339916 CCTATACCTGTAGGAAATGGATA No data
Right 1028832138 7:95339935-95339957 TTCAAGACCCACTTCAGAGGTGG No data
1028832134_1028832136 -9 Left 1028832134 7:95339894-95339916 CCTATACCTGTAGGAAATGGATA No data
Right 1028832136 7:95339908-95339930 AAATGGATACTAAAATTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028832134 Original CRISPR TATCCATTTCCTACAGGTAT AGG (reversed) Intergenic
No off target data available for this crispr