ID: 1028832137

View in Genome Browser
Species Human (GRCh38)
Location 7:95339932-95339954
Sequence CTTTTCAAGACCCACTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028832131_1028832137 30 Left 1028832131 7:95339879-95339901 CCTCAGACTCTCAGACCTATACC No data
Right 1028832137 7:95339932-95339954 CTTTTCAAGACCCACTTCAGAGG No data
1028832135_1028832137 9 Left 1028832135 7:95339900-95339922 CCTGTAGGAAATGGATACTAAAA No data
Right 1028832137 7:95339932-95339954 CTTTTCAAGACCCACTTCAGAGG No data
1028832134_1028832137 15 Left 1028832134 7:95339894-95339916 CCTATACCTGTAGGAAATGGATA No data
Right 1028832137 7:95339932-95339954 CTTTTCAAGACCCACTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028832137 Original CRISPR CTTTTCAAGACCCACTTCAG AGG Intergenic
No off target data available for this crispr