ID: 1028832138

View in Genome Browser
Species Human (GRCh38)
Location 7:95339935-95339957
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028832134_1028832138 18 Left 1028832134 7:95339894-95339916 CCTATACCTGTAGGAAATGGATA No data
Right 1028832138 7:95339935-95339957 TTCAAGACCCACTTCAGAGGTGG No data
1028832135_1028832138 12 Left 1028832135 7:95339900-95339922 CCTGTAGGAAATGGATACTAAAA No data
Right 1028832138 7:95339935-95339957 TTCAAGACCCACTTCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028832138 Original CRISPR TTCAAGACCCACTTCAGAGG TGG Intergenic