ID: 1028832178

View in Genome Browser
Species Human (GRCh38)
Location 7:95340313-95340335
Sequence AAGTGGGTGCAGAAATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028832174_1028832178 -3 Left 1028832174 7:95340293-95340315 CCTGGAGATACTGTACTTTGAAG No data
Right 1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG No data
1028832172_1028832178 21 Left 1028832172 7:95340269-95340291 CCTAACGTGGAGGTCAGAACATC No data
Right 1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG No data
1028832171_1028832178 30 Left 1028832171 7:95340260-95340282 CCTAGTGGACCTAACGTGGAGGT No data
Right 1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028832178 Original CRISPR AAGTGGGTGCAGAAATTGGA TGG Intergenic
No off target data available for this crispr