ID: 1028832874

View in Genome Browser
Species Human (GRCh38)
Location 7:95345442-95345464
Sequence TGGTGCCTACTCTGGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028832863_1028832874 14 Left 1028832863 7:95345405-95345427 CCCAATAATTTGCAAATGCAATG No data
Right 1028832874 7:95345442-95345464 TGGTGCCTACTCTGGGGGTGGGG No data
1028832864_1028832874 13 Left 1028832864 7:95345406-95345428 CCAATAATTTGCAAATGCAATGC No data
Right 1028832874 7:95345442-95345464 TGGTGCCTACTCTGGGGGTGGGG No data
1028832862_1028832874 29 Left 1028832862 7:95345390-95345412 CCATTAAGGAAGTGGCCCAATAA No data
Right 1028832874 7:95345442-95345464 TGGTGCCTACTCTGGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028832874 Original CRISPR TGGTGCCTACTCTGGGGGTG GGG Intergenic
No off target data available for this crispr