ID: 1028834362

View in Genome Browser
Species Human (GRCh38)
Location 7:95357971-95357993
Sequence CCCACGTGCCCAGAGGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028834362_1028834367 8 Left 1028834362 7:95357971-95357993 CCATACCCCTCTGGGCACGTGGG No data
Right 1028834367 7:95358002-95358024 TCTGTGCCAAGTTCAAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028834362 Original CRISPR CCCACGTGCCCAGAGGGGTA TGG (reversed) Intergenic
No off target data available for this crispr