ID: 1028834367

View in Genome Browser
Species Human (GRCh38)
Location 7:95358002-95358024
Sequence TCTGTGCCAAGTTCAAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028834358_1028834367 11 Left 1028834358 7:95357968-95357990 CCCCCATACCCCTCTGGGCACGT No data
Right 1028834367 7:95358002-95358024 TCTGTGCCAAGTTCAAGTGTAGG No data
1028834362_1028834367 8 Left 1028834362 7:95357971-95357993 CCATACCCCTCTGGGCACGTGGG No data
Right 1028834367 7:95358002-95358024 TCTGTGCCAAGTTCAAGTGTAGG No data
1028834359_1028834367 10 Left 1028834359 7:95357969-95357991 CCCCATACCCCTCTGGGCACGTG No data
Right 1028834367 7:95358002-95358024 TCTGTGCCAAGTTCAAGTGTAGG No data
1028834364_1028834367 3 Left 1028834364 7:95357976-95357998 CCCCTCTGGGCACGTGGGAATTT No data
Right 1028834367 7:95358002-95358024 TCTGTGCCAAGTTCAAGTGTAGG No data
1028834360_1028834367 9 Left 1028834360 7:95357970-95357992 CCCATACCCCTCTGGGCACGTGG No data
Right 1028834367 7:95358002-95358024 TCTGTGCCAAGTTCAAGTGTAGG No data
1028834365_1028834367 2 Left 1028834365 7:95357977-95357999 CCCTCTGGGCACGTGGGAATTTG No data
Right 1028834367 7:95358002-95358024 TCTGTGCCAAGTTCAAGTGTAGG No data
1028834366_1028834367 1 Left 1028834366 7:95357978-95358000 CCTCTGGGCACGTGGGAATTTGC No data
Right 1028834367 7:95358002-95358024 TCTGTGCCAAGTTCAAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028834367 Original CRISPR TCTGTGCCAAGTTCAAGTGT AGG Intergenic
No off target data available for this crispr