ID: 1028837954

View in Genome Browser
Species Human (GRCh38)
Location 7:95395947-95395969
Sequence TTTCCCAAGCAGAATGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028837944_1028837954 22 Left 1028837944 7:95395902-95395924 CCTGATCCTCTCTCCCAAGTCCG 0: 1
1: 0
2: 2
3: 7
4: 182
Right 1028837954 7:95395947-95395969 TTTCCCAAGCAGAATGTTGAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1028837946_1028837954 16 Left 1028837946 7:95395908-95395930 CCTCTCTCCCAAGTCCGGCGTTT 0: 1
1: 0
2: 0
3: 1
4: 67
Right 1028837954 7:95395947-95395969 TTTCCCAAGCAGAATGTTGAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1028837950_1028837954 2 Left 1028837950 7:95395922-95395944 CCGGCGTTTCCAATGGACGTCCT 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1028837954 7:95395947-95395969 TTTCCCAAGCAGAATGTTGAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1028837949_1028837954 8 Left 1028837949 7:95395916-95395938 CCAAGTCCGGCGTTTCCAATGGA 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1028837954 7:95395947-95395969 TTTCCCAAGCAGAATGTTGAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1028837947_1028837954 9 Left 1028837947 7:95395915-95395937 CCCAAGTCCGGCGTTTCCAATGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1028837954 7:95395947-95395969 TTTCCCAAGCAGAATGTTGAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1028837951_1028837954 -7 Left 1028837951 7:95395931-95395953 CCAATGGACGTCCTTTTTTCCCA 0: 1
1: 0
2: 0
3: 15
4: 146
Right 1028837954 7:95395947-95395969 TTTCCCAAGCAGAATGTTGAGGG 0: 1
1: 0
2: 2
3: 23
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028837954 Original CRISPR TTTCCCAAGCAGAATGTTGA GGG Intronic
902206405 1:14871304-14871326 TTCCTCAAGCAGAAGGTTCATGG - Intronic
902643106 1:17779252-17779274 TTGCCCCAGCTGAATGTTGAAGG - Intronic
903240202 1:21977566-21977588 TATGCCAGGCAGAATGTTTAGGG + Intronic
903243950 1:22002200-22002222 TATGCCAGGCAGAATGTTTAGGG + Intronic
907030822 1:51169632-51169654 TTTCTCAAGCATATTATTGAGGG + Intergenic
907832138 1:58074976-58074998 TTTCCAAAGCTGAATTGTGAAGG + Intronic
908051739 1:60240154-60240176 ATTCCTAAGCAAAGTGTTGAAGG - Intergenic
911140899 1:94501539-94501561 TTACCAAAGTAGAAAGTTGAGGG + Intronic
911587952 1:99712856-99712878 TTTCCCCATCAGGATGTTGTAGG + Intronic
912726743 1:112065248-112065270 TGAGCCAAGCAGAATGTTTAGGG + Intergenic
914994139 1:152526508-152526530 TTTCCCATGCTGAATGGTGCAGG - Intronic
915063136 1:153203236-153203258 TTTACCAGCCTGAATGTTGAGGG + Intergenic
915256523 1:154635241-154635263 TTCCCAAAGCAGTTTGTTGAGGG - Intergenic
917983416 1:180289774-180289796 TCTCCAAAACATAATGTTGAAGG + Intronic
919704834 1:200666741-200666763 TTTCCTTAACAGAATATTGAAGG - Exonic
920196660 1:204232201-204232223 ATTTCCAAGCAAAGTGTTGAAGG + Intronic
920317208 1:205085389-205085411 TTTTCAAATCAGAATGTTTAAGG + Intergenic
920571124 1:207018734-207018756 TTTCCCCAGGAGAGTGATGATGG - Exonic
921314826 1:213880636-213880658 ATTTCCAAGCAAAGTGTTGAAGG + Intergenic
922876198 1:228941601-228941623 TTTCCCAAGCAAGATGGGGAAGG - Intergenic
923737318 1:236622924-236622946 ATTTCCAAGCAAAATGTTGAAGG + Intergenic
924726701 1:246678139-246678161 TTTTCCAAGTACAAGGTTGAGGG + Intergenic
1062945937 10:1462068-1462090 TTTCCCAAGCAAAATGCTCACGG + Intronic
1064145589 10:12823870-12823892 GTTGCCAAGCAGAATGTGGCAGG + Intronic
1064358628 10:14642751-14642773 TTTTCTAAGCAAAGTGTTGAAGG - Intronic
1065269059 10:24008096-24008118 TCTTGCAGGCAGAATGTTGAGGG - Intronic
1069299767 10:66891428-66891450 TTTCTAAAACAGAATTTTGAAGG + Intronic
1069835184 10:71303736-71303758 TTGCCCAATCAGCATGTTAAAGG + Intergenic
1070376329 10:75834594-75834616 ATTTCCAAGCAAAGTGTTGAAGG - Intronic
1070831716 10:79421988-79422010 TTTCCCCACCAGTATGTTGATGG + Intronic
1071687366 10:87774065-87774087 TTTCACAAACATAATGTAGAAGG + Intronic
1074285293 10:112092091-112092113 TTTACCTGGAAGAATGTTGAAGG - Intergenic
1074671400 10:115796178-115796200 TGTCCCAAGCAGGGTGATGACGG - Intronic
1074839678 10:117337506-117337528 TTTCCCAAGCAATAGCTTGAGGG - Intronic
1077922177 11:6649835-6649857 TGTAGCAACCAGAATGTTGAAGG + Intronic
1078397550 11:10994615-10994637 ATTTCCAGGCAGAGTGTTGAAGG - Intergenic
1079735509 11:23992891-23992913 TTTCCTAAGGAGAATTTAGATGG - Intergenic
1080113180 11:28592744-28592766 GTTTCCAGGCAGAGTGTTGAAGG - Intergenic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081759970 11:45570351-45570373 TTTCCCAAGCAGCACTATGAGGG + Intergenic
1083915411 11:65740024-65740046 TTTATCAAGCAAAATGTAGAAGG + Intergenic
1084535960 11:69757211-69757233 ATTCCCAATCAGAAGGATGAAGG + Intergenic
1086948371 11:92866729-92866751 TTCCCCACGCAGATTGTGGATGG + Exonic
1087226679 11:95608423-95608445 TTTCCCAATCAGGATGGTCAGGG + Intergenic
1088582912 11:111332497-111332519 TTTGCCACACAGAATGTTAAAGG + Intergenic
1090187324 11:124746976-124746998 TTTCCCCAGCGCACTGTTGAGGG + Exonic
1090420700 11:126573102-126573124 TTTTCCACCCAGAATGTGGAGGG - Intronic
1090481724 11:127074811-127074833 TTGCGGGAGCAGAATGTTGACGG + Intergenic
1090572621 11:128064327-128064349 TTTCCCATTCAGAATGATGTTGG - Intergenic
1090733822 11:129594047-129594069 TTTCCCAAGCTGTATTTTGGGGG + Intergenic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1092438726 12:8477115-8477137 TTTTGCCAGCAGAATGTTAAAGG + Intronic
1094708371 12:32936836-32936858 ATTTCCAAACAGAGTGTTGAAGG + Intergenic
1096053627 12:48632529-48632551 TGTCTCAAGCAGAATGCTTAAGG + Intergenic
1096861934 12:54535488-54535510 TTTCCCAACCAGATTGTAAATGG - Intronic
1096897629 12:54839946-54839968 TTTCACAAGCAGAAAGTTCTGGG + Intronic
1097593186 12:61596503-61596525 TTTTCCATCCAGAAAGTTGAGGG - Intergenic
1098339363 12:69436010-69436032 TTTCCCAAATATAATGTTGAGGG + Intergenic
1098634896 12:72770611-72770633 GTTTCCAAGCAAAATGTTGAAGG - Intergenic
1098946066 12:76591087-76591109 ATTTCCAAGCAAAGTGTTGAAGG + Intergenic
1099778386 12:87163559-87163581 ATTTCTAAGCAGAGTGTTGAAGG - Intergenic
1100363941 12:93902153-93902175 CCTCCCAAGGACAATGTTGATGG - Intergenic
1104161325 12:126183647-126183669 ATTCCCAAGCAAAATGTTGAAGG + Intergenic
1105972405 13:25441673-25441695 TATGCCAAGCAGGATGTTGTAGG - Intronic
1106325663 13:28686233-28686255 TTCCCCAATCAGAATGATGTTGG + Intergenic
1108005786 13:45944921-45944943 TTTCACAAGCAGACTTTGGAGGG - Intergenic
1110872926 13:80473634-80473656 TTTCCCATGCAGAGTATTGATGG - Intergenic
1111482858 13:88854735-88854757 ATTCTTAAGCAAAATGTTGAAGG + Intergenic
1113098831 13:106695409-106695431 TTTGGCAAGAAGAATGATGATGG + Intergenic
1113322396 13:109247357-109247379 TGTCACTAGCAGAATGTTAAAGG + Intergenic
1113472545 13:110557278-110557300 ATTTCCAAGCAAAGTGTTGAAGG + Intronic
1114276412 14:21149629-21149651 ATTTTCAAGCAGAATGTTTAAGG - Intergenic
1114444261 14:22776163-22776185 TTTCACTAGCAGAAGGTTGAGGG - Intronic
1114678848 14:24465752-24465774 TCTCACAAGCATAATGTTAAGGG - Intergenic
1115123748 14:29969293-29969315 TTCCCAAAGCAGCATGTTTAGGG - Intronic
1116181121 14:41537479-41537501 TTTCCCATTCAGTATGTTGCTGG + Intergenic
1116689429 14:48085646-48085668 TTTACTGAGCAGAATTTTGAAGG - Intergenic
1117954230 14:61110449-61110471 TTTCCAAAGCACTATGTTAACGG - Intergenic
1118077336 14:62314378-62314400 TTTCCCAAGCAGCATACTGTAGG + Intergenic
1121552011 14:94809984-94810006 TCTCCCAAGCAGATTGTCCATGG - Intergenic
1121881244 14:97502290-97502312 ATTTCTAAGCAAAATGTTGAAGG + Intergenic
1122164661 14:99813118-99813140 TTTGCCAAGCAGAAGGATTATGG + Intronic
1122787169 14:104169093-104169115 TGTCTCAAGGAGACTGTTGAGGG - Intronic
1123540500 15:21285010-21285032 TTCCCAAAGCAGAAAGTAGACGG - Intergenic
1125390201 15:39184371-39184393 TTTGCCAAGCACAATGAAGAGGG + Intergenic
1125392341 15:39207531-39207553 ATTTCCAAGCAAAGTGTTGAAGG + Intergenic
1127233622 15:57023404-57023426 TTTTTCAAGCAGAATGGGGAGGG - Intronic
1127270991 15:57401973-57401995 TGTTCCAAGCAGTATGTAGAAGG - Intronic
1129074767 15:72984234-72984256 ATTTCCAAGCAAAGTGTTGAAGG - Intergenic
1130303407 15:82697640-82697662 TTTCCCAAAGAGATTTTTGATGG + Intronic
1132180734 15:99750808-99750830 TTTCCCCAAGAGAATTTTGAGGG - Intergenic
1202948814 15_KI270727v1_random:12152-12174 TTCCCAAAGCAGAAAGTAGACGG - Intergenic
1134191211 16:12122482-12122504 CTCCCCAAGCAGAAGCTTGAAGG + Intronic
1134283365 16:12837965-12837987 ATTTCCAAGCAAAGTGTTGAAGG + Intergenic
1134585622 16:15408017-15408039 TTTTCCCAGCAGAGTGGTGACGG + Exonic
1135292886 16:21255383-21255405 TTTTCCAGGCAGAAGGGTGATGG - Intronic
1136384657 16:29916029-29916051 CTTTCCAGACAGAATGTTGAAGG - Intronic
1138902574 16:61291963-61291985 TTTCCCTATCAGAATGTTTTGGG - Intergenic
1139921119 16:70461280-70461302 TTTCCCATGCTGAGTTTTGAGGG + Intronic
1143285152 17:5783441-5783463 ATTTCCAAGCAAAGTGTTGAAGG - Intronic
1145124868 17:20291937-20291959 TTTCCCAAGAGCAATGCTGACGG - Intronic
1147512213 17:41080769-41080791 ATTTCCAAGAAAAATGTTGAAGG + Intergenic
1147844103 17:43392912-43392934 GTTCCCAAGAAGAATGTCTAGGG - Intergenic
1149345462 17:55730141-55730163 TTTCCCAACCAACATGTTCATGG - Intronic
1156600014 18:38594780-38594802 TTTCTCCAGCAGAGTGCTGAGGG - Intergenic
1157659849 18:49431383-49431405 TTCCCTAAACAGTATGTTGAAGG + Intronic
1158836691 18:61337267-61337289 TATCCGAAGTAGAATGTGGAGGG - Intronic
1158899543 18:61949939-61949961 TTTCCGAAGGGGAATGGTGAGGG - Intergenic
1163591899 19:18198535-18198557 TTTGCCATGCAGAAAGTTTAAGG - Intronic
1164878474 19:31710851-31710873 TTTCTCAACCACCATGTTGAGGG + Intergenic
1165592774 19:36985391-36985413 TTTCCCTAATAAAATGTTGAGGG - Intronic
1165677139 19:37736252-37736274 ACTCCCAAGCAGAATGTTGAAGG + Intronic
1166137081 19:40784060-40784082 TTTGCCCAGGAGAATGGTGAGGG + Exonic
1166935248 19:46328497-46328519 ATTCCCAGCCAGAGTGTTGAAGG - Intronic
1167986677 19:53324327-53324349 TTACCCAAGCAGATTTTGGAGGG - Intergenic
925482117 2:4286708-4286730 ATTTCCAAGCATAGTGTTGAAGG + Intergenic
925777860 2:7352513-7352535 TTTCCAAAGCTGAAACTTGAAGG - Intergenic
925839088 2:7974238-7974260 TTTCCTAAGAAGAATGTGCAAGG + Intergenic
926552170 2:14314002-14314024 TGTCCCAGGGAGAATGTGGAAGG - Intergenic
926711928 2:15888842-15888864 GTGCCCAAGCAGAGTGGTGACGG + Intergenic
928626327 2:33143161-33143183 TTGCCCAAGCAGAATGGGTAGGG - Intronic
928862014 2:35870036-35870058 TTTCCCAAACTGAATTCTGATGG - Intergenic
930460844 2:51673527-51673549 TTTCTCAAGCAGAACTGTGAAGG + Intergenic
931957528 2:67444077-67444099 ATTTCCAAGAAGAATATTGATGG - Intergenic
932061676 2:68506859-68506881 TCTCCCTACCATAATGTTGAGGG + Intronic
932235606 2:70118877-70118899 TTTCCCGAGCTGACTGATGAAGG + Intergenic
932686191 2:73872262-73872284 TTTCCAAAGAAGAATGGTGGTGG + Intronic
933367211 2:81368009-81368031 TGTGCCAAGCAGCATGTTGGCGG + Intergenic
935390727 2:102549999-102550021 TTTCTCAAGGATAATTTTGATGG - Intergenic
935810668 2:106794087-106794109 GTTCCCTATCTGAATGTTGAAGG - Intergenic
936633974 2:114234576-114234598 TTTCCTGAGCAGAATCTGGAGGG - Intergenic
938900094 2:135792383-135792405 TTTCCTGAGCAGAATCTTGGGGG + Intronic
939045566 2:137245816-137245838 TTTCCCAAAAAGTCTGTTGAAGG - Intronic
939385210 2:141487117-141487139 TTTCCCAGGCAAAAGGTGGAGGG - Intronic
940311636 2:152285276-152285298 TTCCACAAGCAGAATCTTGTGGG - Intergenic
940721030 2:157281871-157281893 AGTACCAAGCAAAATGTTGAAGG + Intronic
941179814 2:162245697-162245719 TTTCTCAACAAAAATGTTGATGG - Intergenic
943277899 2:185891583-185891605 TTCCACAAACAGAATGTTCAAGG + Intergenic
945029697 2:205651782-205651804 TTTCCCAAGCAGAAATTGTAAGG - Intergenic
945284262 2:208066317-208066339 ATGTCCAAGCAGAATGTAGAAGG + Intergenic
945886857 2:215385204-215385226 TTTTCCAAATAAAATGTTGAGGG - Intronic
946538087 2:220653083-220653105 ATTGCCTAGCAGATTGTTGAAGG + Intergenic
947328444 2:229002903-229002925 ATTTCCAAGCAGAGTGTTGAAGG - Intronic
947491031 2:230594382-230594404 TTTACCCAGCAGACTGTTGTGGG - Intergenic
948041119 2:234902421-234902443 TTTCCCAGGCAGAATGATGGGGG + Intergenic
948564330 2:238874074-238874096 CATCCCAGGCAGGATGTTGATGG + Intronic
948680570 2:239631548-239631570 TTTCCAAAGGAGGAAGTTGATGG + Intergenic
1169055855 20:2620142-2620164 ATTCCCAAGCAAAGTATTGAAGG + Intronic
1169313128 20:4564802-4564824 ATTCCCAAGCAAAGTGTTGAAGG + Intergenic
1170509683 20:17063872-17063894 TTTCCCAAGTGGAAAGTTGGAGG - Intergenic
1171020359 20:21579243-21579265 TTTTCCATGCAGCATGTTGAAGG + Intergenic
1171221390 20:23401098-23401120 TTCCCCAAACAGAATGTTGCTGG - Intronic
1171437863 20:25136928-25136950 TGTGTCCAGCAGAATGTTGATGG - Intergenic
1173439089 20:43059369-43059391 CTTTCTAAGCAAAATGTTGAAGG - Intronic
1173660999 20:44733647-44733669 TTTCCTAGGCAGAAAGTCGAGGG - Intergenic
1173739950 20:45393066-45393088 ATTTCCAAGCAAAATGTTAAAGG - Intronic
1176206308 20:63890264-63890286 TTAGCCCATCAGAATGTTGAAGG + Exonic
1176960980 21:15158490-15158512 TTACCCAAACAGAATCTTGGTGG + Intergenic
1177203155 21:17980141-17980163 TTTCTCAGGCAAAATGTAGATGG - Intronic
1181929233 22:26386256-26386278 ATTCCAAAGCAAAGTGTTGAAGG - Intergenic
1182080569 22:27525827-27525849 TTTCCTGAACAGAATGTTCATGG - Intergenic
1182527960 22:30933301-30933323 AATCCCAAGCAGAATTCTGAAGG - Intronic
1182940067 22:34268428-34268450 TTTCCTAAGCTAAGTGTTGAAGG + Intergenic
1184943450 22:47784749-47784771 TTTCCCAAGCAGATGGTGGAAGG + Intergenic
949233169 3:1775293-1775315 ATTTCCAAGCAAAATGTTGAAGG - Intergenic
950941308 3:16895812-16895834 TCTCCCAAGCATAATGCTAAGGG + Intronic
952774671 3:37033192-37033214 TTTTCCACACAGAATGTTCATGG - Intronic
952961503 3:38593861-38593883 TTTCTCCAGCTGATTGTTGATGG + Intronic
953142931 3:40246252-40246274 TTTTCCAAACAGGATTTTGAGGG + Intronic
953260907 3:41338319-41338341 TTTCACAGTTAGAATGTTGAGGG - Intronic
953835946 3:46344294-46344316 TTTTCCCAGCAGAATGTGGTAGG + Intergenic
957240914 3:77660277-77660299 ATTTCCAAGCAGAGTGTTGAAGG - Intergenic
960435383 3:117620123-117620145 TTTGCCAATCTGAATTTTGATGG + Intergenic
961308178 3:125974298-125974320 TTTCTCAAGCACATTGTTAAAGG + Intronic
961470949 3:127111893-127111915 TTTCCATAAGAGAATGTTGATGG - Intergenic
962319576 3:134379114-134379136 TTTCTCAAGCTGAGTGCTGAAGG + Intergenic
962611440 3:137080402-137080424 TGTCACAAGCAGAGTTTTGATGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963622404 3:147627629-147627651 TTTTGCAAGCAGAAAGTTGGAGG + Intergenic
966393513 3:179477345-179477367 ATTCCTAAGCAAAATATTGAAGG - Intergenic
967527911 3:190515030-190515052 TTTCACAACCAGAAGGTGGAGGG - Intronic
967800629 3:193654871-193654893 TTTCCCACAAAGATTGTTGAAGG - Exonic
968130932 3:196192479-196192501 TTCCCCAAGCAGAAAGCTGCTGG + Intergenic
969544260 4:7814054-7814076 TTTCCTTAGCAGTATGTGGACGG - Intronic
972490918 4:39586306-39586328 ATTTCTAAGCAAAATGTTGAAGG - Intronic
973779403 4:54274019-54274041 TTAGACAAGCAAAATGTTGAGGG - Intronic
973948364 4:55984422-55984444 TTTTCCTAGCAGAATATTCATGG + Intronic
974664126 4:64936085-64936107 ATTTCTAAGCAAAATGTTGAAGG - Intergenic
976326736 4:83780115-83780137 TTTCCCAAGCAGAATGGTTGGGG + Intergenic
979069616 4:116185537-116185559 ATTTCTAAGCAAAATGTTGAAGG + Intergenic
979781909 4:124662430-124662452 TTTCACAAACATAATGTTAAGGG + Intergenic
980162066 4:129176638-129176660 TGTTCCAAACAGAATATTGAAGG - Intergenic
980272068 4:130597318-130597340 ATTTCCAGGCAAAATGTTGAAGG + Intergenic
981548318 4:145916792-145916814 ATTTCTAAGCAAAATGTTGAAGG - Intronic
982460300 4:155662078-155662100 ATTCCTAAGCAAAATGGTGAAGG - Intergenic
982781097 4:159492303-159492325 GTTTCTAAGCAGAATATTGAAGG + Intergenic
982936715 4:161487176-161487198 TTTCCCAAACATAATGCTGAAGG + Intronic
983788596 4:171765180-171765202 TTTCCCAAGCAGGAACTTAAGGG - Intergenic
983813330 4:172091518-172091540 TTTCCCAAGGAGATTTTTAATGG + Intronic
983968718 4:173845116-173845138 ATTTCCAGGCAGAATGTTGAGGG + Intergenic
984161049 4:176252339-176252361 TGTCCCTAGCTGAATGTTGCGGG - Intronic
984338561 4:178423898-178423920 ATTTCTAAGCAAAATGTTGAAGG - Intergenic
984395801 4:179198295-179198317 TATCCCAAGCAGAGTTTTCATGG - Intergenic
984556712 4:181222932-181222954 TTCAGCAAGCAGAATGTGGATGG + Intergenic
984721198 4:182974733-182974755 TTTGCCAGGCAGAATACTGAGGG + Intergenic
986328795 5:6702508-6702530 TATACCCAGCAGAATCTTGAGGG + Intergenic
987802689 5:22719391-22719413 TCTCTCAGGAAGAATGTTGAAGG - Intronic
987815377 5:22894311-22894333 TTTTCCAAGAAGAAAGTTTATGG + Intergenic
988083879 5:26447595-26447617 TGACCCAAGCATAATGGTGAAGG + Intergenic
988272041 5:29029475-29029497 TTTCTCAATGAGAATGTTGCTGG - Intergenic
989069193 5:37492696-37492718 ATTTCTAAGCAAAATGTTGAAGG + Intronic
989680398 5:44022278-44022300 ATTCCTAAGCAAAATATTGAAGG + Intergenic
989708986 5:44373487-44373509 ATTTCCAAGCAAAGTGTTGAAGG - Intronic
992161472 5:74008043-74008065 TTTCTCAAGCAGGATGATGAGGG - Intergenic
992480345 5:77145235-77145257 ATTTCCAAGCAAAGTGTTGAAGG + Intergenic
998672878 5:144373416-144373438 TTTCACAAGCTGAAAATTGATGG - Intronic
1000641998 5:163713664-163713686 TTTCATAATGAGAATGTTGAAGG - Intergenic
1001621553 5:173090004-173090026 TTTTTCAGGCAGAATGTTTATGG + Intronic
1004562571 6:16763349-16763371 TTTGCCAAGCAGGGTGTTGGGGG - Intergenic
1008837794 6:55858284-55858306 TTTTCAAAATAGAATGTTGACGG + Intronic
1010275394 6:73962913-73962935 TTTTCCAAAGAGAATTTTGAGGG + Intergenic
1011661730 6:89600683-89600705 TTTCTCTATCAGAATGGTGACGG - Intronic
1012594101 6:101020662-101020684 TTTACCCACCAGCATGTTGAGGG - Intergenic
1012833328 6:104233029-104233051 TTTCCCAAGGGAACTGTTGAAGG + Intergenic
1013493468 6:110673956-110673978 TTTCCCAAGTAGAAGGTTTGTGG + Intronic
1016511410 6:144847432-144847454 TTTCCCAAAAAGGATTTTGAGGG + Intronic
1017756971 6:157537997-157538019 TTTTCTAAGCAGCATTTTGAAGG + Intronic
1019800361 7:3084032-3084054 TGGCCCAAGGAGAGTGTTGATGG + Intergenic
1019836469 7:3390104-3390126 ATTTCCAAGCAAATTGTTGAAGG + Intronic
1020019091 7:4851659-4851681 GTTTCCAAGCAGAGTGTAGAAGG + Intronic
1020218943 7:6219284-6219306 TTTTCCAAGCAGAGTGTTAAAGG + Intronic
1020809861 7:12838603-12838625 TTTCTGAAGCAGAAGGCTGAGGG - Intergenic
1021314584 7:19131482-19131504 TTTCCCAAGTCAAATGTTCATGG - Intergenic
1021411517 7:20333998-20334020 TTACACCAGGAGAATGTTGAGGG + Intronic
1021885609 7:25135305-25135327 TTTCTCAATCAGAAGGTTAAGGG + Exonic
1022070462 7:26908588-26908610 ATTCCCAGGCAAAATATTGAAGG + Intronic
1023172379 7:37402217-37402239 TTTATCAAGCAGAATATTGCTGG - Intronic
1024415637 7:49102800-49102822 ATTCTCAAGCAGAAAGTAGAGGG - Intergenic
1028473220 7:91226828-91226850 ATTTCTAGGCAGAATGTTGAAGG - Intergenic
1028837954 7:95395947-95395969 TTTCCCAAGCAGAATGTTGAGGG + Intronic
1030180793 7:106706932-106706954 TATCCCAAGCAGGAATTTGAAGG - Intergenic
1033984647 7:147209690-147209712 TTTCCCATGCAGTATGATGTTGG + Intronic
1036083861 8:5591181-5591203 TTTCCAAAATACAATGTTGAAGG - Intergenic
1037415409 8:18644344-18644366 ATTTCAAAGCAAAATGTTGATGG - Intronic
1037996670 8:23357400-23357422 TTTCAAAAGCAGAATTTTCATGG - Intronic
1038132400 8:24747451-24747473 TTTCCTAAGAAGAATATTAAGGG - Intergenic
1038821575 8:30956998-30957020 TATCCCAGGAAGCATGTTGAGGG + Intergenic
1039720154 8:40155156-40155178 TTTCCCAAGCAATATGTTTTGGG + Exonic
1039836495 8:41260395-41260417 TTTCCCAATCAGAATGTCTGGGG + Intergenic
1041480948 8:58319074-58319096 TTTCCCAAGCACACAGTCGATGG + Intergenic
1043645659 8:82515151-82515173 TTTCTCAAGCACAGTGGTGATGG - Intergenic
1045620440 8:103971208-103971230 TTTCCCATTGAAAATGTTGAGGG + Intronic
1045959793 8:107953651-107953673 TTTCCTAAGCAGCAGGATGATGG + Intronic
1046199699 8:110908730-110908752 TTTCCCATTCAGAATGATGTTGG + Intergenic
1046610970 8:116425205-116425227 TCTCACAAGCATAATATTGAGGG + Intergenic
1048934930 8:139347029-139347051 TTTACCAAGGAGTATCTTGAAGG - Intergenic
1049005664 8:139854099-139854121 TTTCTCCTGTAGAATGTTGAAGG - Intronic
1050084334 9:1949031-1949053 TGTCCCACCCAGAATGCTGATGG - Intergenic
1051534077 9:18137394-18137416 TTTCCAAAGATGAATATTGAAGG - Intergenic
1051562123 9:18453626-18453648 ATTTCCAAGCAAAATATTGAGGG - Intergenic
1052386500 9:27829467-27829489 ATTCCCAAGGAGAATCTGGAAGG + Intergenic
1052711887 9:32067135-32067157 ATTTCCAAGCAAAGTGTTGAAGG + Intergenic
1185663861 X:1748843-1748865 TTTCCCAAGCAATGTGTTCAGGG + Intergenic
1187118448 X:16379060-16379082 CTTACCAAGGAGAATGTTGATGG - Intergenic
1187185560 X:16981482-16981504 GTTCTCTAGCAGAATGCTGAAGG + Intronic
1187203629 X:17160155-17160177 ATTTCCAAGCAAAATGTTGAAGG + Intergenic
1188230044 X:27650900-27650922 TTTCCCATGCAGTATGATGTTGG + Intronic
1189003838 X:36974390-36974412 TTCACCAAGCAGTAGGTTGAAGG + Intergenic
1189647167 X:43145680-43145702 TTTCTCAGGCAAAAAGTTGAAGG - Intergenic
1190132005 X:47756626-47756648 TGTCCCAAGCAGAAGTTTCATGG + Intergenic
1193987841 X:88268222-88268244 TCTACCAGGCAGAGTGTTGAAGG + Intergenic
1194322224 X:92462600-92462622 TTCCCAAAGCAAAATTTTGAGGG - Intronic
1194755385 X:97733075-97733097 ATTTTCAGGCAGAATGTTGAGGG + Intergenic
1194862711 X:99022766-99022788 TTTCATAAACAGATTGTTGATGG - Intergenic
1195576981 X:106462361-106462383 ATTTCCAAAAAGAATGTTGACGG + Intergenic
1196296813 X:114007135-114007157 ATTTCCAAGCAAAATGTTAAAGG + Intergenic
1197058326 X:122147404-122147426 ATTTCTAAGCAGAATGTTGTGGG + Intergenic
1197625844 X:128801566-128801588 TTTACCCAGCAGAATCTTTAGGG - Intergenic
1197696522 X:129555666-129555688 TTTCTCAAGCAACATGGTGAGGG + Intronic
1200299499 X:154958446-154958468 TTTTCCATGGAGAATTTTGAAGG - Intronic
1200630382 Y:5576077-5576099 TTCCCAAAGCAAAATTTTGAGGG - Intronic