ID: 1028838762

View in Genome Browser
Species Human (GRCh38)
Location 7:95403226-95403248
Sequence GCTCCTATTACTCCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028838762_1028838763 -6 Left 1028838762 7:95403226-95403248 CCAGGATGTGGAGTAATAGGAGC No data
Right 1028838763 7:95403243-95403265 AGGAGCTCTCATTCACTGCTTGG No data
1028838762_1028838764 23 Left 1028838762 7:95403226-95403248 CCAGGATGTGGAGTAATAGGAGC No data
Right 1028838764 7:95403272-95403294 TGCAAAGCAGTATAGCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028838762 Original CRISPR GCTCCTATTACTCCACATCC TGG (reversed) Intergenic
No off target data available for this crispr