ID: 1028838894

View in Genome Browser
Species Human (GRCh38)
Location 7:95404843-95404865
Sequence AATTAAACACAGACAAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 801
Summary {0: 1, 1: 1, 2: 2, 3: 52, 4: 745}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028838890_1028838894 -4 Left 1028838890 7:95404824-95404846 CCTAGCCATATGCCTTCAGAATT 0: 1
1: 0
2: 1
3: 17
4: 177
Right 1028838894 7:95404843-95404865 AATTAAACACAGACAAAACTGGG 0: 1
1: 1
2: 2
3: 52
4: 745
1028838889_1028838894 4 Left 1028838889 7:95404816-95404838 CCATTTCTCCTAGCCATATGCCT 0: 1
1: 0
2: 2
3: 35
4: 383
Right 1028838894 7:95404843-95404865 AATTAAACACAGACAAAACTGGG 0: 1
1: 1
2: 2
3: 52
4: 745
1028838887_1028838894 26 Left 1028838887 7:95404794-95404816 CCATAAGGAAGCAGCTGCTTTCC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1028838894 7:95404843-95404865 AATTAAACACAGACAAAACTGGG 0: 1
1: 1
2: 2
3: 52
4: 745
1028838891_1028838894 -9 Left 1028838891 7:95404829-95404851 CCATATGCCTTCAGAATTAAACA 0: 1
1: 0
2: 1
3: 18
4: 200
Right 1028838894 7:95404843-95404865 AATTAAACACAGACAAAACTGGG 0: 1
1: 1
2: 2
3: 52
4: 745
1028838888_1028838894 5 Left 1028838888 7:95404815-95404837 CCCATTTCTCCTAGCCATATGCC 0: 1
1: 0
2: 0
3: 6
4: 155
Right 1028838894 7:95404843-95404865 AATTAAACACAGACAAAACTGGG 0: 1
1: 1
2: 2
3: 52
4: 745

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028838894 Original CRISPR AATTAAACACAGACAAAACT GGG Intergenic
900305461 1:2004650-2004672 AATTAAAAACAGCAAAAACCCGG + Intergenic
900664284 1:3803776-3803798 AATTAGACAGAGTCATAACTTGG - Intergenic
900730031 1:4251923-4251945 ACTTAAACTCACACAAAACTGGG - Intergenic
903575843 1:24339270-24339292 AAAAAAAAAAAGACAAAACTGGG - Intronic
903858864 1:26353435-26353457 ATTTCAACACAAATAAAACTAGG + Intronic
903949114 1:26984212-26984234 AATCAAACACAGAGAAATCTGGG + Intergenic
904070637 1:27793990-27794012 AATTAAAAAAAAAAAAAACTAGG - Intronic
904098422 1:28000902-28000924 AAGTAAACACAGAAATAGCTGGG + Intronic
904930717 1:34085170-34085192 AATTGAACAATGACAACACTTGG + Intronic
906594244 1:47060046-47060068 AATGAATCCAAGACAAAACTAGG - Intergenic
906770882 1:48481797-48481819 AATTAAACATAAACAAAAGTAGG - Intergenic
906838697 1:49112059-49112081 AGTAGAACACAGACAAAGCTAGG - Intronic
906945576 1:50291666-50291688 AATTAAACAATGAGAACACTTGG + Intergenic
907310523 1:53536467-53536489 AATGAAACACACACAGCACTTGG - Intronic
907733650 1:57091060-57091082 AAGTAAGCAGAGGCAAAACTTGG - Intronic
908102269 1:60803719-60803741 AATTAAACATTGAGAACACTTGG - Intergenic
908465768 1:64392592-64392614 AATTAAACACACACTATCCTAGG - Intergenic
908557646 1:65272874-65272896 ATTAAAACACACACAAAAATAGG - Intronic
908630528 1:66101032-66101054 AATTGAACAATGACAACACTTGG - Intronic
908658163 1:66410056-66410078 AATAAAACACTCAAAAAACTAGG + Intergenic
908735984 1:67277587-67277609 AATTAAAAAAAAAAAAAACTAGG + Intergenic
908888857 1:68819662-68819684 AATTCACAACAGACAAAACCTGG + Intergenic
909111048 1:71478017-71478039 AATTAAACAGAGACAATCTTTGG - Intronic
909159835 1:72132493-72132515 AAATAAACAAACAAAAAACTTGG + Intronic
909247230 1:73301607-73301629 AATTTAAAACATACAAATCTTGG + Intergenic
909771426 1:79427076-79427098 AAATAAACACAGAAGAGACTAGG + Intergenic
910090034 1:83451285-83451307 AATTAAACAATGAGAACACTTGG - Intergenic
910131272 1:83909847-83909869 AATTAAAAACTGACCAAATTTGG + Intronic
910204194 1:84731609-84731631 AATGAAAAACAGAAAAAAGTAGG - Intergenic
910435689 1:87203078-87203100 ATTTAGAGACAGAAAAAACTGGG + Intergenic
911221031 1:95246702-95246724 AATTATACTCTGACAAATCTAGG + Intronic
911364190 1:96916737-96916759 AATTGAACAATGAGAAAACTTGG + Intergenic
911791558 1:102022320-102022342 AATGAAGCACAGAAAAAAGTAGG - Intergenic
911879228 1:103213211-103213233 CATTAAACAAATACAAAAATAGG + Intergenic
912072599 1:105830873-105830895 TATTCAACACTGACAACACTGGG - Intergenic
912081543 1:105943509-105943531 AATTGAACAATGACAACACTTGG - Intergenic
913446241 1:118953695-118953717 ACTTAAAAAAAGAAAAAACTTGG - Intronic
913792517 1:122554102-122554124 AATTGAACACACACAACACAAGG - Intergenic
913802801 1:122738369-122738391 AATTGAACACACACAACACAAGG - Intergenic
913816409 1:122982485-122982507 AGTTAAACACACACAACACAAGG - Intergenic
913828482 1:123198829-123198851 AGTTGAACACACACAAAACAAGG - Intergenic
913829185 1:123211406-123211428 AGTTGAACACAGACAACACAAGG - Intergenic
913849256 1:123571798-123571820 AGTTGAACACACACAACACTAGG - Intergenic
913860286 1:123769451-123769473 AATTGAACACACACAACACATGG - Intergenic
913865346 1:123860538-123860560 AATTGAACACACACAACACAAGG - Intergenic
913870412 1:123951447-123951469 AGTTGAACACACACAAAACAAGG - Intergenic
913875971 1:124051039-124051061 AGTTGAACACAGACAACACAAGG - Intergenic
913883102 1:124178729-124178751 AGTTGAACACAGACAACACAAGG - Intergenic
913883381 1:124183824-124183846 AGTTAAACACACACAACACAAGG - Intergenic
913898256 1:124449654-124449676 AGTTGAACACACACAACACTAGG - Intergenic
915743221 1:158135801-158135823 AATTAAACAATGAGAACACTTGG - Intergenic
916220747 1:162442814-162442836 AATTAGACACATACAGAACAGGG + Intergenic
916526092 1:165610871-165610893 AATTCAAGACATACAAAAGTGGG + Intergenic
917368108 1:174256246-174256268 TATTAAACAAAGCCAAAAATGGG - Intronic
917645395 1:177024334-177024356 TATTAAAAACAAACAAAAATGGG + Intronic
917933481 1:179840684-179840706 AATTGAACAAAGAAAACACTTGG + Exonic
918713153 1:187756734-187756756 AATTGAACAATGACAACACTTGG - Intergenic
918993168 1:191724660-191724682 AATTAAAGACAGAAAGAAATAGG + Intergenic
919038973 1:192357298-192357320 ACTTGAACACACACAATACTAGG - Intronic
919168380 1:193924216-193924238 AAGTAGAAACAGACAAAACCAGG + Intergenic
919582668 1:199396778-199396800 AATTACAAAAAGACAAAACACGG + Intergenic
920785982 1:209041659-209041681 AATTAAACAACGAGAACACTTGG + Intergenic
921117909 1:212112054-212112076 CATTAAACAAAGACAATACATGG + Intergenic
921239098 1:213158735-213158757 ATTTTAGCACAGAAAAAACTTGG - Intronic
921693519 1:218180784-218180806 AATTCAACAAAGACAGAACAGGG + Intergenic
921909912 1:220537087-220537109 AATTAAAAAAAAAAAAAACTAGG - Intronic
923326375 1:232883883-232883905 AATGAAGAACAGACAAAAATAGG - Intergenic
923382259 1:233433142-233433164 AATTAAAGAAAGGAAAAACTGGG - Intergenic
924166699 1:241291118-241291140 AAATAAACACAGACAAAGCCAGG + Intronic
1063015685 10:2074798-2074820 AATTAAAGACACCCAATACTAGG - Intergenic
1063397553 10:5704506-5704528 AATTAATCAAGGACAAAACAAGG - Intronic
1063728524 10:8668211-8668233 AACCAAACCCAGACAAAACTGGG + Intergenic
1064260937 10:13785822-13785844 AATTGAACACTGAGAACACTTGG - Intronic
1064653081 10:17529106-17529128 AAATAAAAAAAGACAAAACATGG + Intergenic
1064720119 10:18220555-18220577 AAATAAACACAGATAAGGCTGGG - Intronic
1065223145 10:23516499-23516521 AATCAAAGACAGAATAAACTGGG - Intergenic
1065515196 10:26517603-26517625 AAAAAAACAAAAACAAAACTTGG - Intronic
1065760664 10:28979857-28979879 AGTTAAACAAAGGAAAAACTAGG + Intergenic
1067695540 10:48532687-48532709 AATTGAACAAAGAGAACACTTGG - Intronic
1068075149 10:52243622-52243644 AATTAAACACCGGAAAAATTAGG - Intronic
1068242350 10:54319246-54319268 TATTCACAACAGACAAAACTTGG + Intronic
1068292967 10:55029729-55029751 AATTAAACAGAGAGAAAAGTTGG - Intronic
1068297595 10:55094331-55094353 AATTGAACACTGAGAACACTTGG + Intronic
1068815183 10:61301798-61301820 AATGAATCACAGTCTAAACTTGG + Intergenic
1069098251 10:64286695-64286717 AATGAAACACAGACAGAAGCAGG - Intergenic
1069118861 10:64543242-64543264 AATTAAAGATAGACAACCCTTGG + Intergenic
1069541751 10:69299657-69299679 AAAAAAACACAAACAAAGCTGGG - Intronic
1070613927 10:77954283-77954305 AATTACAAAAAGACAAAATTGGG - Intergenic
1071406331 10:85336816-85336838 AATTGAACAAAGACAGAAATTGG - Intergenic
1071516211 10:86299605-86299627 AATTGAACAATGACAACACTTGG + Intronic
1071544288 10:86516445-86516467 AAGTAAACACAGACAAAACTTGG - Intronic
1071925130 10:90397965-90397987 AAGGAAACACAGAAAAAAATAGG + Intergenic
1072341220 10:94452709-94452731 TATTAACAACAGCCAAAACTTGG - Intronic
1074166911 10:110888406-110888428 ACTTAATGACAGACAATACTCGG + Intronic
1074262935 10:111871932-111871954 AATTCAACACAGTCAGAAATTGG + Intergenic
1074278067 10:112023815-112023837 AATGAAACCCAGAGAAACCTGGG - Intergenic
1074326101 10:112452832-112452854 TGTTAATCACAGAGAAAACTGGG - Intronic
1074592602 10:114827444-114827466 AATTAAACAATGACAAAAGTGGG + Intronic
1074662144 10:115672744-115672766 AATTTAAGAAAGACAAAAATTGG - Intronic
1074950633 10:118331370-118331392 ATCTCAACACAGACAAACCTAGG + Intronic
1075189895 10:120297431-120297453 AATTAAACAGAGGCAAAAAGAGG + Intergenic
1075436772 10:122450302-122450324 AATTAACCACAGTTAACACTGGG + Intergenic
1075607976 10:123829487-123829509 AATTAAACACAAACAGTACCAGG + Intronic
1076703690 10:132289450-132289472 AATAAAACACACACATAAATGGG + Intronic
1076885970 10:133262574-133262596 GCTTAAACACACACAAAGCTGGG + Exonic
1078472541 11:11603174-11603196 AATTCAACATGGAGAAAACTGGG + Intronic
1078696759 11:13641631-13641653 ATTTAAAAAGAAACAAAACTGGG - Intergenic
1078746716 11:14122597-14122619 AATGAAGCACAGAGAAAAATGGG - Intronic
1078863882 11:15278753-15278775 AACTGAACACAGACAAGAGTGGG + Intergenic
1079377158 11:19903722-19903744 TAGGAAACACACACAAAACTTGG - Intronic
1079808722 11:24968152-24968174 AATCAAACCTAGACAGAACTTGG - Intronic
1080329414 11:31118375-31118397 CATAAAACACAATCAAAACTAGG + Intronic
1080785554 11:35472055-35472077 AAGTAAACACTGATGAAACTCGG - Intronic
1080979292 11:37380945-37380967 AATTGAACAAAGAGAAAACTTGG - Intergenic
1081037253 11:38164206-38164228 AATTGAACAATGAGAAAACTTGG - Intergenic
1081124750 11:39308947-39308969 AATTGAACAATGACAACACTTGG - Intergenic
1081346432 11:41992794-41992816 AATTACTCACACACAAAACATGG + Intergenic
1081515253 11:43822533-43822555 AATTGAACAATGACAACACTTGG - Intronic
1081878412 11:46427280-46427302 AATGAACCATAGAAAAAACTTGG - Intronic
1082860753 11:57853778-57853800 AATTGAACAATGAGAAAACTTGG + Intergenic
1083006727 11:59354112-59354134 AAAAAAACACACACAAATCTTGG - Intergenic
1085499670 11:77008273-77008295 CATTAAAAACAGAATAAACTGGG - Intronic
1085629896 11:78106190-78106212 AATGAAAAAAAGAAAAAACTTGG - Intronic
1085994709 11:81897024-81897046 AATTAACCACAGATAAGACATGG + Intergenic
1086267565 11:85019669-85019691 AATTGAACAATGACAACACTTGG - Intronic
1086522544 11:87687087-87687109 AATTTAAAACAGAAAAAAGTAGG + Intergenic
1086549338 11:88036947-88036969 AAAGACACACACACAAAACTAGG - Intergenic
1086780823 11:90903248-90903270 AATTCAACAAAACCAAAACTTGG + Intergenic
1086781172 11:90908353-90908375 TATTAAACACAGAGCAGACTTGG + Intergenic
1087120748 11:94571486-94571508 AATTAAACAATGAGAACACTTGG - Intronic
1087167308 11:95017835-95017857 AAATACACACAGTCAAAAATGGG - Intergenic
1087391042 11:97535697-97535719 AAATAAAAACAAACAAAAATCGG - Intergenic
1087568524 11:99894642-99894664 ATTTATAAACAGACAAAAATAGG + Intronic
1087753019 11:102026207-102026229 AATTAAAAACAAAAAAACCTTGG + Intergenic
1087909211 11:103733775-103733797 TATTAAACACAGAAAAAGATAGG - Intergenic
1088028643 11:105219042-105219064 AATTAAACAAAGACATATCAAGG + Intergenic
1088310295 11:108452940-108452962 AATTAAACAATGAGAACACTTGG + Intronic
1088411135 11:109535998-109536020 AATTAAACAATGAGAACACTTGG + Intergenic
1089025643 11:115266884-115266906 TATTAAAAATACACAAAACTAGG + Intronic
1089063472 11:115644806-115644828 AATTAAACACAGACCTAAGATGG - Intergenic
1089144108 11:116311799-116311821 AATGAAACACAGACACATATAGG - Intergenic
1089248829 11:117143227-117143249 AATTGAACACTGAGAACACTTGG + Intergenic
1091177062 11:133569647-133569669 AATTAAGTACAAATAAAACTGGG - Intergenic
1091626923 12:2128333-2128355 AAATAAAAACAAACAAAATTTGG + Intronic
1092325017 12:7521748-7521770 AATTGAACACTGAGAACACTTGG - Intergenic
1092620165 12:10255299-10255321 AAATAAACAAAGCCAAAAGTTGG - Intergenic
1092707024 12:11296149-11296171 AATTAAACAATGAGAACACTTGG + Intergenic
1092715462 12:11384936-11384958 AATTGAACAATGAGAAAACTTGG + Intronic
1092808918 12:12253625-12253647 AATTAAACAGTGAGAACACTTGG - Intronic
1092846299 12:12588361-12588383 AATTAAATTAGGACAAAACTAGG - Intergenic
1093009104 12:14085346-14085368 AATTGAACAATGACAACACTTGG + Intergenic
1093009444 12:14090211-14090233 AATTGAACAATGACAACACTTGG - Intergenic
1093486585 12:19659565-19659587 TATTAAACTCAGCCAAAGCTGGG - Intronic
1093648977 12:21621436-21621458 AATTGAACAATGACAACACTTGG - Intergenic
1093766589 12:22970375-22970397 AATCAAATGAAGACAAAACTGGG - Intergenic
1093937313 12:25015102-25015124 AAAAAAAAAAAGACAAAACTTGG + Intergenic
1094062834 12:26332961-26332983 AATTGAACAATGAGAAAACTTGG - Intergenic
1094456983 12:30645880-30645902 AACAAAACACAGACAAAAATAGG + Intronic
1095116802 12:38363934-38363956 AATTGAACACTGAGAACACTTGG + Intergenic
1095381368 12:41597548-41597570 AATTAAACACAAAGAAAAGTAGG - Intergenic
1096877229 12:54639425-54639447 AATTGAACAATGACAACACTTGG + Intergenic
1097554858 12:61123782-61123804 AATTAACAACAGTTAAAACTTGG - Intergenic
1097564059 12:61246204-61246226 AATTAAGCTCAGAAAAAAGTTGG - Intergenic
1098098917 12:66991583-66991605 AAGAAAACATAGAGAAAACTTGG + Intergenic
1098130484 12:67345037-67345059 AATTAAACAATGAGAACACTTGG - Intergenic
1098215905 12:68218526-68218548 AATGAAACACAGAAAAGACTGGG + Intronic
1098505702 12:71248046-71248068 ACTTAAACATAAAGAAAACTAGG + Intronic
1098683478 12:73388402-73388424 AAATAAAGGCAGAGAAAACTTGG + Intergenic
1098732905 12:74061488-74061510 AATTAAACAATGAGAACACTAGG + Intergenic
1099109585 12:78541268-78541290 AATAAAACACAGGGAAAACAAGG - Intergenic
1099120064 12:78678432-78678454 AATATAACACATAGAAAACTAGG + Intergenic
1099388750 12:82051773-82051795 AATTGAACAAAGAGAACACTTGG + Intergenic
1099447016 12:82764914-82764936 AAGACAACACAGACAAAACAGGG + Intronic
1099624113 12:85046942-85046964 AATTAAACAATGAGAACACTTGG + Intronic
1099994229 12:89759827-89759849 AATTAAACAAATACAAAATTTGG - Intergenic
1100004053 12:89872900-89872922 AATGAAAGACACAAAAAACTTGG + Intergenic
1100053213 12:90476441-90476463 AATTGAACAATGACAACACTTGG - Intergenic
1100233659 12:92635555-92635577 CATTAATCACAGGGAAAACTGGG + Intergenic
1100538109 12:95530826-95530848 AATTAAAAACAGTCAACAATAGG + Intronic
1101297960 12:103445280-103445302 CAATCAACACAGACAAAACGTGG - Intronic
1101313511 12:103607587-103607609 AATTAAACAATGAGAACACTTGG - Intronic
1102033433 12:109757901-109757923 CAGCAAACACAGACAAATCTGGG + Intronic
1103532503 12:121612111-121612133 AGTTACAAACTGACAAAACTGGG + Intergenic
1103832399 12:123790162-123790184 AATTTAACACAGAGAAAACATGG - Intronic
1105865833 13:24458407-24458429 AATTAAAAAAAAAAAAAACTTGG - Intronic
1106316008 13:28594324-28594346 AATTAAACAAAAATAAAACAAGG + Intergenic
1106795578 13:33201357-33201379 AAATAATCACTGACAAAAATAGG - Intronic
1107665298 13:42682468-42682490 AATTAAAAACAAAAAAAACAGGG + Intergenic
1107924807 13:45248394-45248416 AAAAAAACACAAAAAAAACTTGG - Intronic
1108232910 13:48369079-48369101 CTTTAAGAACAGACAAAACTAGG - Intronic
1108730249 13:53227872-53227894 AAATAAACCCAAACAACACTTGG + Intergenic
1108804250 13:54134403-54134425 AATTGAACAATGAGAAAACTTGG + Intergenic
1109318432 13:60780108-60780130 AATGAAAAACAGAAAAAAGTAGG - Intergenic
1109346495 13:61120509-61120531 AATTAATAACAGACAAAAAAAGG + Intergenic
1109672746 13:65631323-65631345 AATGAAACAAAAACAAAACCTGG - Intergenic
1109888060 13:68568388-68568410 AATTAATCAGTGACACAACTGGG - Intergenic
1110123793 13:71915951-71915973 AATTAAACTTAGCCAAAATTAGG + Intergenic
1110148859 13:72225969-72225991 AATTGAACAAAGAGAACACTTGG - Intergenic
1110583176 13:77156951-77156973 AATTAAAACCAGAAAAAAGTTGG + Intronic
1111076601 13:83244356-83244378 AATTGAACAAAGAGAACACTTGG - Intergenic
1111406874 13:87818804-87818826 AATTAAGCATAAATAAAACTGGG + Intergenic
1111755161 13:92384069-92384091 AATTAAACATATACAAAGATTGG + Intronic
1112272217 13:97978046-97978068 AAGTAAACACACCCAAAATTCGG + Intronic
1112534730 13:100241461-100241483 AATAAAAAACAGACAAAATGTGG - Intronic
1112670821 13:101635946-101635968 CATTTAAAACAGACATAACTTGG - Intronic
1113252368 13:108468201-108468223 AATTAAACAATAACATAACTAGG - Intergenic
1113385926 13:109848013-109848035 AATTAAAAGAAAACAAAACTTGG - Intergenic
1113770141 13:112903012-112903034 AATTAAATGCAGGCAAAACTAGG - Intronic
1114067869 14:19080619-19080641 AATTGAACAAAGAGAACACTTGG + Intergenic
1114094391 14:19319407-19319429 AATTGAACAAAGAGAACACTTGG - Intergenic
1114858000 14:26475762-26475784 AATTAAATGTAGACATAACTAGG + Intronic
1114931806 14:27479629-27479651 ATTGTAACACAGCCAAAACTAGG - Intergenic
1115459288 14:33641698-33641720 AAATAAACACCGAGAAAATTAGG - Intronic
1115995789 14:39194431-39194453 AATTAAAAATATAGAAAACTCGG + Intergenic
1116609287 14:47046392-47046414 AATTAAACAATGACAATACTTGG + Intronic
1116985387 14:51213813-51213835 AATTAAACAATGAGAACACTTGG - Intergenic
1117005074 14:51412875-51412897 AAGATAACACAGACAAAAATGGG + Intergenic
1117284524 14:54273947-54273969 AATTGAACAATGACAACACTTGG - Intergenic
1118001046 14:61523995-61524017 ATTTCAAAACAGACAAAAGTAGG - Intronic
1118094145 14:62517545-62517567 AATTGAACAATGAGAAAACTTGG - Intergenic
1118148970 14:63167128-63167150 AATAATACACAAACAAAACAAGG + Intergenic
1118187809 14:63553420-63553442 ACTTAAACACAGTGATAACTTGG - Intergenic
1119869635 14:78005306-78005328 AATTAAATGCAAACAAAAGTAGG + Intergenic
1119960382 14:78849004-78849026 AATTATGCACAGAGAAAACTTGG + Intronic
1120097915 14:80409885-80409907 AATTAAAAACAGAAAATAATTGG - Intergenic
1120346489 14:83296900-83296922 ATTTAAACTCACACAAATCTTGG + Intergenic
1120492727 14:85197158-85197180 AATTGAACAATGAGAAAACTTGG + Intergenic
1120958448 14:90103517-90103539 ATTCAAACACACATAAAACTAGG + Intronic
1121597386 14:95175425-95175447 AATTATACATAGATAAAACAAGG + Intergenic
1123021775 14:105401522-105401544 AATTGAACAATGACAACACTTGG + Intronic
1123195546 14:106612302-106612324 CATTGAACTCAGACAAAACTGGG + Intergenic
1202904814 14_GL000194v1_random:63115-63137 AAATAAAAAAACACAAAACTGGG - Intergenic
1123520739 15:21070425-21070447 AATTGAACAAAGAGAACACTTGG + Intergenic
1124106764 15:26745365-26745387 ATGTAAACACTGAGAAAACTGGG - Intronic
1124844874 15:33280397-33280419 AATTAAACAATGAGAACACTTGG - Intergenic
1124850941 15:33338446-33338468 AAGAGAACACAGACAAAACGGGG + Intronic
1125139390 15:36386367-36386389 AATGAAAAACAGACAAATATTGG + Intergenic
1125828864 15:42697639-42697661 GTTGAAACACAGTCAAAACTTGG + Intronic
1126074581 15:44896925-44896947 AATTAATAACAGATAAAACTTGG + Intergenic
1126083777 15:44990898-44990920 AATTAATAACAGATAAAACTTGG - Intergenic
1126129128 15:45323755-45323777 AAGATAACACAGACAAAACGGGG - Intergenic
1126580861 15:50241455-50241477 TATTAAAGACAAACAAAGCTGGG - Intergenic
1126768131 15:52029304-52029326 AATTAAAAAAAAACAAAGCTAGG - Intronic
1127249086 15:57211173-57211195 AATTAAACAATGACAAAGTTAGG + Intronic
1127721376 15:61703534-61703556 AATCAACCACATACAAAATTAGG - Intergenic
1128165893 15:65464379-65464401 AATTTAAAAAAAACAAAACTAGG + Intronic
1128565134 15:68696083-68696105 AATTAAAAAAAAAAAAAACTAGG + Intronic
1128695094 15:69755831-69755853 AATTAGACACAAACAAGGCTGGG - Intergenic
1128780196 15:70354153-70354175 CATTAAACACAAACAAAGCTGGG - Intergenic
1129084637 15:73075940-73075962 AATTCAAAACAGACAAAAATAGG - Intronic
1130571190 15:85045411-85045433 AATTAAATTCAGACAGAACTGGG + Intronic
1130804879 15:87309462-87309484 AATTAAAAAAAGAAAAAATTAGG - Intergenic
1131849971 15:96528650-96528672 TATTAAACAAAGAGAAAAGTTGG - Intergenic
1131900318 15:97080761-97080783 CATTAAGCACAGAGAAAATTGGG + Intergenic
1133134990 16:3704695-3704717 AAGTAAACACACACAAAAAAAGG + Intronic
1133986820 16:10675190-10675212 ATTTATACACAGAAAGAACTTGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135247346 16:20868337-20868359 AACTAAACACAGACAAACTGAGG + Intronic
1136080748 16:27851184-27851206 AAAAACAAACAGACAAAACTTGG - Intronic
1136373634 16:29851444-29851466 AAAAAAACACAAAAAAAACTAGG + Intergenic
1136630504 16:31487053-31487075 AAACAAAAACAAACAAAACTGGG + Intronic
1137105463 16:36458273-36458295 AGTTAAACACACACATCACTAGG - Intergenic
1137580604 16:49631470-49631492 AATTACAGAAAGACAGAACTTGG + Intronic
1138006795 16:53344621-53344643 AATTGAACAATGACAACACTTGG - Intergenic
1138507045 16:57483648-57483670 AATTAAAAAAATACAAAAATTGG + Intronic
1138969489 16:62127684-62127706 ATTTAAACACAAGCAAACCTAGG - Intergenic
1139190364 16:64856186-64856208 GAATGAAAACAGACAAAACTTGG + Intergenic
1139368769 16:66451783-66451805 AATAAGACACAGACAATCCTGGG - Intronic
1140018512 16:71213119-71213141 AATTTAAGACAAACAAACCTGGG + Intronic
1141049755 16:80750025-80750047 AATTGAACAAAGAGAACACTTGG + Intronic
1141248665 16:82334623-82334645 AATTAAACAACGAGAACACTTGG - Intergenic
1141277071 16:82597927-82597949 AAAAAAACACACACATAACTGGG + Intergenic
1141773202 16:86103911-86103933 AATTGAAAACAGAAATAACTTGG - Intergenic
1141877673 16:86837245-86837267 ATTTCAAAACAGACAAAGCTGGG + Intergenic
1142083290 16:88162293-88162315 AATTCAACACTGAAAAAAATTGG + Intergenic
1143228334 17:5327747-5327769 ATTTAAAAATAGACAAAAGTAGG + Intronic
1143696044 17:8619621-8619643 ATTCAAAAACAGGCAAAACTAGG + Intronic
1143876702 17:9996993-9997015 GATAGAAAACAGACAAAACTTGG + Intronic
1144135503 17:12291180-12291202 AAATAAACAGACACAAAAATTGG - Intergenic
1144190161 17:12838347-12838369 AAGAAAACACATACAAAAGTTGG + Intronic
1144449110 17:15360596-15360618 AATTAAACAATGAGAACACTTGG + Intergenic
1144679806 17:17185523-17185545 AATAAAAAACAAACAAAAATAGG - Exonic
1145038637 17:19559859-19559881 AAAAAAAAACAGACAAAACCTGG + Intronic
1146297972 17:31665113-31665135 AATTAAACAATGAGAACACTTGG - Intergenic
1146834117 17:36096001-36096023 GATTAAAAAGAGACAAAACTAGG - Intergenic
1146848671 17:36202584-36202606 GATTAAAAAGAGACAAAACTAGG - Intronic
1148255591 17:46128769-46128791 AAATAAAAGCAGACAGAACTTGG + Intronic
1148482333 17:47968135-47968157 GATTAAACACACACTTAACTGGG - Intronic
1148890923 17:50806456-50806478 AATCCAACACAGAGAAAATTTGG - Intergenic
1150608818 17:66716640-66716662 AATTATCAACAGACAAATCTGGG + Intronic
1150661386 17:67083155-67083177 AATTAAAAACATTTAAAACTGGG - Intronic
1150696801 17:67412327-67412349 AAGTAGATACTGACAAAACTAGG + Intronic
1151584271 17:74999258-74999280 AATAAAAAACAAACAAAAATAGG - Intronic
1151857705 17:76734718-76734740 AATTAAAAACCTACAAAAGTTGG - Exonic
1153533399 18:6073079-6073101 AAATCAACACAGCCAAAAATTGG + Intronic
1153605793 18:6830053-6830075 GAAGAAACACAGACAAAAATAGG - Intronic
1153711686 18:7806470-7806492 AATTAATCACAGACTAATTTGGG + Intronic
1153813216 18:8770214-8770236 ACTAAAACACAGTCAAAAGTTGG - Intronic
1153823686 18:8855447-8855469 AATTAAAAACAAACAAGGCTGGG + Intergenic
1153862004 18:9221047-9221069 AATGAAACACGGACAAAACAAGG - Intronic
1154403980 18:14070884-14070906 AATTGAACAAAGAGAACACTTGG + Intronic
1155743614 18:29322320-29322342 AATTTAACACATACAACACTTGG + Intergenic
1155870663 18:31023455-31023477 ATTTAAAAAGAAACAAAACTAGG + Intronic
1156356646 18:36348074-36348096 AATAAAACCAACACAAAACTCGG - Intronic
1156418260 18:36921823-36921845 AATAAAACACAACCATAACTAGG - Intronic
1156580950 18:38374313-38374335 AAACAAACACACACAAAACTAGG + Intergenic
1156705831 18:39880771-39880793 CATTAAACACAAATAAGACTTGG - Intergenic
1156718924 18:40046282-40046304 AATTGAAAACAGACAAAAGGTGG + Intergenic
1156956034 18:42964537-42964559 AAGATAACATAGACAAAACTGGG - Intronic
1157029740 18:43891134-43891156 AATTAAACAATGAGAACACTTGG + Intergenic
1157069300 18:44387218-44387240 ATTTAAAAACTGACAAAATTAGG - Intergenic
1157954399 18:52081141-52081163 AAGTAAACATATGCAAAACTAGG + Intergenic
1158089440 18:53693728-53693750 AAATAACCACAGACTGAACTTGG - Intergenic
1159275248 18:66210775-66210797 AAATAAATACATACAACACTTGG + Intergenic
1160310977 18:77789830-77789852 AATTAAACAATGAGAACACTTGG + Intergenic
1161598594 19:5165988-5166010 AGTTAAACACAGACCAGGCTTGG + Intronic
1164110618 19:22154299-22154321 AATTGAACAATGACAACACTTGG + Intergenic
1164110730 19:22155707-22155729 AATTGAACAATGACAACACTTGG - Intergenic
1164666223 19:30039638-30039660 AATTAAACACAGAAAGAAAAAGG - Intergenic
1164797821 19:31049077-31049099 AATTAAAGGCAAACAAAACAGGG - Intergenic
1165184880 19:34009408-34009430 AAATAAACACAAGTAAAACTGGG + Intergenic
1165678469 19:37749886-37749908 AAATCAACACACAGAAAACTTGG + Intronic
1165679087 19:37757983-37758005 AATTAAACAATGAGAACACTTGG + Intronic
1166094028 19:40528728-40528750 AAGTAAAGACAGACATACCTAGG - Intronic
1167720104 19:51173576-51173598 AAATAAGCACAGACTATACTGGG + Intergenic
1167982679 19:53288495-53288517 AATTAAAAAGAGTCAAAAATGGG - Intergenic
1168183511 19:54680918-54680940 AGATAAACATAGACAAAATTGGG - Intronic
1168569764 19:57456646-57456668 AAGTAAATACAAGCAAAACTAGG + Exonic
925325369 2:3016544-3016566 AATTAAAGACACACCAAAATTGG + Intergenic
925614201 2:5729779-5729801 ATTTAAAATCAGACAAATCTGGG + Intergenic
925630729 2:5890325-5890347 AATTGAACAATGACAACACTTGG - Intergenic
925837528 2:7960375-7960397 AAATAACTTCAGACAAAACTTGG + Intergenic
926042726 2:9687478-9687500 AAATGAACACAGACTACACTAGG + Intergenic
926164147 2:10507769-10507791 TGTTAAACACTTACAAAACTGGG + Intergenic
926221160 2:10936411-10936433 AAGTAAACAATGACAAAGCTTGG + Intergenic
926582558 2:14647248-14647270 AATAAAACACATTCAAAAATTGG - Intronic
927286513 2:21362726-21362748 AATTAAACAAAGAAAAAAGGCGG - Intergenic
927337636 2:21943496-21943518 AATTAAATATAGAAAAAAATAGG + Intergenic
927650137 2:24907697-24907719 AATTAAGAATAGACAAGACTGGG + Intronic
927859018 2:26548219-26548241 AATTTAACAAAGCCAAAAGTTGG - Intronic
927875883 2:26654985-26655007 AATTACACACAGGAAAAACATGG + Intergenic
928090596 2:28372079-28372101 AATTAAACAATGAGAACACTTGG + Intergenic
928182264 2:29076917-29076939 AAATAAAGAAAGACAAAAGTTGG - Intergenic
928547783 2:32344096-32344118 AAAAAAACACCCACAAAACTGGG + Intergenic
929192706 2:39154370-39154392 AAATAAAAACACACAAAAATAGG - Intergenic
929343883 2:40856947-40856969 AATTAAACAATGAGAACACTTGG + Intergenic
929927234 2:46224186-46224208 AATTGAACAATGACAACACTTGG + Intergenic
930267516 2:49217306-49217328 AATTATACACATAAAAAAATTGG + Intergenic
930487767 2:52028969-52028991 AAATAAAAAAAGACAAAAGTAGG - Intergenic
930839671 2:55831730-55831752 AATTAAACAATGAGAACACTTGG - Intergenic
930901403 2:56511448-56511470 AAGTAAACACACACCAACCTGGG - Intergenic
931027389 2:58127404-58127426 AGTTTCACACACACAAAACTAGG + Intronic
932747302 2:74344570-74344592 AATCAAAGACAGGCAAGACTAGG + Intronic
932813968 2:74846817-74846839 AATCAACCACAGTCAAAACAGGG - Intronic
933007926 2:77019692-77019714 ATTTTAAGACAGACTAAACTTGG + Intronic
934511704 2:94949632-94949654 AATTGAACAATGAAAAAACTTGG - Intergenic
935315171 2:101826115-101826137 AATTACACACAGACATTACTTGG + Intronic
935440726 2:103092780-103092802 AATTAAAAACAGAAAAAAGCAGG - Intergenic
935877810 2:107530575-107530597 AATAAAACTCAGAAAAAAATAGG - Intergenic
936225045 2:110641209-110641231 TATTAAACACAAACAAAGCCAGG + Intronic
936563598 2:113563852-113563874 AATTGAACACACAAAAAAATAGG + Intergenic
937017882 2:118622507-118622529 AAGTTAAAACAGACATAACTAGG - Intergenic
937729851 2:125215563-125215585 AATAAAACATTGACAAAAATAGG + Intergenic
939201108 2:139035543-139035565 CATTAAACTGAGACAAAACAAGG - Intergenic
939374484 2:141346132-141346154 AAATAAAAACAAACAAAACATGG - Intronic
939845060 2:147233144-147233166 AATTGAACAATGAGAAAACTTGG + Intergenic
940014629 2:149091031-149091053 GATTATACACAGACTAAAGTAGG + Intronic
940082656 2:149822053-149822075 AATTAAACACTGAGAACACATGG + Intergenic
940432820 2:153613675-153613697 AATTAAACAATGAGAACACTTGG - Intergenic
940518211 2:154708558-154708580 AATTAAATACAGAAAAAAATGGG - Intronic
940982564 2:160019944-160019966 AAGTACACACAGAAAAAACATGG - Intronic
941042851 2:160642663-160642685 AATTGAACAATGACAACACTTGG - Intergenic
941043259 2:160646893-160646915 AACAAAACTCAGACAAGACTGGG + Intergenic
941591058 2:167421201-167421223 AATTAAACTTAGATAAAATTAGG + Intergenic
941999950 2:171636198-171636220 AATAAAAAACAAACAACACTGGG - Intergenic
942374408 2:175322368-175322390 ATTTAAAAACAGATAAAAGTTGG - Intergenic
942592769 2:177563377-177563399 AACTAAACAAAGAGAAGACTAGG - Intergenic
943831339 2:192466556-192466578 AATAAAAAGCAGTCAAAACTGGG + Intergenic
943987779 2:194644690-194644712 AATTGAACAATGAGAAAACTTGG + Intergenic
944152066 2:196570491-196570513 AATTAAACAATGAGAACACTTGG + Intronic
944197427 2:197069239-197069261 AATTGAACAATGAGAAAACTTGG + Intronic
944266708 2:197734749-197734771 AATTGAACAATGAGAAAACTTGG + Intronic
944942654 2:204646082-204646104 AATTAAACACATTTAAAAATAGG + Intronic
945158221 2:206861420-206861442 AATTAAATAGAGACAAACATGGG - Intergenic
945349994 2:208766072-208766094 AATTGAACACTGAGAACACTTGG + Intronic
945558333 2:211306644-211306666 AATTAACAATAGGCAAAACTGGG + Intergenic
945741287 2:213665669-213665691 AAATAAACACACATAAAACAAGG - Intronic
946092114 2:217236556-217236578 AAATAAACACAGAAATAACAAGG - Intergenic
946672745 2:222123709-222123731 AATTATACACACACAACAGTTGG + Intergenic
946755184 2:222937445-222937467 AAGCAAACACTGACATAACTAGG - Intronic
946931650 2:224677279-224677301 AGTCAAAAACAGACAAAACTCGG - Intergenic
947199906 2:227605762-227605784 AAGTAAAAACAGACAAATCCTGG + Intergenic
947214067 2:227734452-227734474 AATTGAACAATGAGAAAACTTGG + Intergenic
948053911 2:234997343-234997365 AATTTGCCACGGACAAAACTCGG - Intronic
948097484 2:235347746-235347768 AATTTGTCAAAGACAAAACTTGG - Intergenic
948119119 2:235515810-235515832 AATTAAACACGCACAGAGCTGGG + Intronic
949020325 2:241737481-241737503 AAATAAAAAAAGAGAAAACTGGG - Intronic
1168742450 20:203680-203702 AATTAAACAATGAAAACACTTGG - Intergenic
1168820626 20:771019-771041 AGTTCAACACAGGCAAAACAGGG - Intergenic
1169324810 20:4666901-4666923 AATTAACCACAGTTAATACTGGG + Intergenic
1169700795 20:8444240-8444262 AATTGAACAATGAGAAAACTTGG - Intronic
1170258054 20:14368550-14368572 AAACACACACACACAAAACTGGG + Intronic
1170726227 20:18929433-18929455 AATTAAACAATGAGAACACTTGG - Intergenic
1172072342 20:32267396-32267418 AATTAAAAACGGACAAAAGCTGG - Intergenic
1172556679 20:35848242-35848264 AATCATTCTCAGACAAAACTTGG - Intronic
1172944899 20:38679654-38679676 AATTAAACACAGAGACTGCTGGG - Intergenic
1173436276 20:43034820-43034842 AGCTAAGCACAGACAAAACCCGG - Intronic
1174039327 20:47687913-47687935 AATGAAACACACACAAGCCTGGG - Intronic
1175432105 20:58912590-58912612 AAATAAACACACATAAAACCTGG + Intergenic
1175528629 20:59657394-59657416 ATTTACACACACACAAAACAAGG - Intronic
1175656937 20:60779208-60779230 AATTAATCAAAGACAATAATTGG - Intergenic
1176624181 21:9077880-9077902 AAATAAAAAAACACAAAACTGGG - Intergenic
1176916857 21:14636011-14636033 AATTAAACAATGAGAACACTTGG - Intronic
1177347161 21:19888736-19888758 AATTAAAGACTGGCAATACTTGG + Intergenic
1177392652 21:20496107-20496129 AATTAAACAATGAGAACACTTGG - Intergenic
1177583843 21:23062983-23063005 AAAAAAACAAAAACAAAACTGGG - Intergenic
1177640779 21:23841994-23842016 AATAAAAATCAGACAAAACTAGG - Intergenic
1177849367 21:26328214-26328236 AATTAAACAATGAGAACACTTGG - Intergenic
1178301150 21:31454189-31454211 AAAAAAATACAGACAAAAATCGG - Intronic
1179002318 21:37473902-37473924 AATTAAACACTTCCTAAACTTGG - Intronic
1179330008 21:40390721-40390743 ACTTAAACACAGAGAGAACATGG - Intronic
1179567039 21:42255713-42255735 AAGTCAACACAAACAAAACCAGG - Intronic
1180486343 22:15803188-15803210 AATTGAACAAAGAGAACACTTGG + Intergenic
1180849787 22:19010852-19010874 ATTTAAAAACATAAAAAACTGGG - Intergenic
1180906761 22:19418750-19418772 AAATAAGTACAAACAAAACTGGG + Intronic
1181698316 22:24606338-24606360 AATTAAACAATGAGAACACTTGG - Intronic
1182655704 22:31888224-31888246 AAAAAACCACAGACAAAACAAGG - Intronic
1183148860 22:36021186-36021208 AATTAAACAATGAGAACACTTGG + Intronic
1183497780 22:38159103-38159125 AAATAAACAAAGCCAAAAGTTGG + Intronic
1183756621 22:39772590-39772612 AACCAAACACCGACAAAACAAGG + Intronic
1183808708 22:40236120-40236142 AATTAAATACAAGTAAAACTGGG - Intronic
1184532460 22:45064914-45064936 AATTAAAGACAGACACACGTAGG + Intergenic
949381525 3:3451357-3451379 ATTTAAACATACACAAAAGTTGG - Intergenic
949668742 3:6373442-6373464 AATTAAACAATGAGAACACTTGG + Intergenic
950299345 3:11862189-11862211 AATTAAACAATGAGAACACTAGG - Intergenic
950480389 3:13240072-13240094 AATTAAAAAAAAACAAACCTTGG + Intergenic
950645671 3:14375160-14375182 GAATAAAAACAGACAAAGCTGGG + Intergenic
950899332 3:16483027-16483049 AAGTAAAAACAAACAAACCTTGG - Intronic
951193829 3:19802650-19802672 AAATAAACAAAGTCAAACCTTGG + Intergenic
951244929 3:20330126-20330148 GATTAAGCGCAGACAATACTTGG + Intergenic
951749676 3:26020401-26020423 AATTAAACAATGAGAACACTTGG - Intergenic
951816463 3:26760620-26760642 AATTAAACAATGAGAACACTTGG + Intergenic
952616003 3:35274854-35274876 AATTAAAAACAGAAAAAAATAGG + Intergenic
953047991 3:39313082-39313104 AATTGAACAAAGAGAACACTTGG + Intergenic
953123424 3:40068606-40068628 AATCAAACACATACAAATCAAGG + Intronic
953728448 3:45422638-45422660 AAATGAACACAAACAGAACTTGG - Intronic
954018059 3:47713020-47713042 AGTTAAAAACAGAAAAATCTGGG + Intronic
954094210 3:48311203-48311225 AATAAAACACCCAGAAAACTAGG + Intronic
955259509 3:57371733-57371755 AACTAAAGACAGAGAAAAATTGG + Intronic
955268756 3:57475230-57475252 AATAAAACACAGAAAGCACTAGG + Intronic
955548906 3:60061538-60061560 AATTACTCACTGACAAAACAGGG - Intronic
955896134 3:63702674-63702696 AAATTAACACAGCCAAAAGTTGG + Intergenic
956045344 3:65190250-65190272 AATGAAACACAGACAAACAGAGG + Intergenic
956568121 3:70662614-70662636 AATTAAACAATGAGAACACTTGG + Intergenic
956614189 3:71154702-71154724 TATTAAATAGAGATAAAACTAGG + Intronic
957172207 3:76752228-76752250 AATTAAACAATGAGAACACTTGG + Intronic
957330250 3:78754345-78754367 AAAAAAACACAGACAAAATGAGG + Intronic
957509272 3:81166885-81166907 AATAAAACTGAGACAAAAATAGG - Intergenic
957523066 3:81345943-81345965 ATTCTAACACAGACAAATCTGGG - Intergenic
957563592 3:81856573-81856595 AATTGAACACTTACAAAAATCGG + Intergenic
957899839 3:86475046-86475068 AATTGAACAATGACAACACTTGG + Intergenic
958042195 3:88240274-88240296 AATTAAACATACAAAAAACTAGG + Intergenic
958433391 3:94068484-94068506 ACACAAACACTGACAAAACTGGG - Intronic
958723053 3:97869633-97869655 TATGAAACAAAGTCAAAACTTGG - Intronic
959413676 3:106058202-106058224 AATTAAACACTCACAAAAATAGG - Intergenic
959550394 3:107649368-107649390 AATTAAAAAGTGCCAAAACTAGG - Intronic
959656902 3:108817304-108817326 AATTAAACTCTGAGAAAACTAGG - Intergenic
959778668 3:110201840-110201862 AATTGAACAGTGAGAAAACTTGG - Intergenic
959780179 3:110222445-110222467 AAGTAATCACAGACATTACTTGG + Intergenic
960339131 3:116453950-116453972 AAAAAAACACAGACAAATATGGG - Intronic
960980316 3:123217979-123218001 AATTAAACACTGACATTATTAGG - Intronic
961062590 3:123844150-123844172 TATTAAACAGAGACAAAGCAAGG + Intronic
961144914 3:124585497-124585519 AATTAAATACAGTCCTAACTGGG - Intronic
961507056 3:127377042-127377064 ACTGAAAGACAGACAAAAGTTGG + Intergenic
961836530 3:129665726-129665748 ATTTGAAGTCAGACAAAACTGGG + Intronic
962228771 3:133640937-133640959 TATTAAACACAGAGAATACGGGG + Intronic
962526014 3:136238065-136238087 AGTTGAATACAGACAAATCTAGG + Intergenic
962553004 3:136514852-136514874 AATTGAACACTGAGAACACTTGG + Intronic
963279270 3:143366071-143366093 CATTAAAAACAAACAAAAATTGG - Intronic
963470240 3:145731408-145731430 AAATAAATACAAATAAAACTTGG + Intergenic
963554249 3:146767435-146767457 ATTTAAGCATATACAAAACTTGG - Intergenic
963843889 3:150135133-150135155 AAGCAAACACAGATAAAACTGGG + Intergenic
964654777 3:159054176-159054198 AATTAAAAACACATAAAAGTAGG + Intronic
965100389 3:164290820-164290842 AAGAAAACACAGAGAAAACTAGG + Intergenic
965280416 3:166744966-166744988 AATGAGACACAGACACAATTTGG - Intergenic
965857848 3:173110523-173110545 AATTAAACACATACCATACAGGG + Intronic
966095844 3:176202126-176202148 AAAAAAACAAAAACAAAACTTGG - Intergenic
966102658 3:176291785-176291807 AATAAAACAGAAACAGAACTAGG - Intergenic
966305849 3:178533845-178533867 AATTAGCCACAGATAAAAATTGG + Intronic
966356172 3:179080791-179080813 AATAAAACAAACAAAAAACTAGG - Intergenic
966985336 3:185174881-185174903 AAATAAACAAACAAAAAACTTGG + Intergenic
967445257 3:189558223-189558245 ATATAAACAAAGACAAAAATGGG + Intergenic
967447537 3:189584422-189584444 AATTAAACAATGAGAACACTTGG + Intergenic
967454849 3:189672800-189672822 AATTAAACAAAGCCAACAATTGG + Intronic
967637511 3:191820588-191820610 AAATAAACACAGACACAAATGGG - Intergenic
968240680 3:197081423-197081445 ACTTAAAAACAAACAAAACTTGG - Intronic
968258028 3:197297432-197297454 AATTAAGAACAGACAGAAGTCGG + Intronic
969473773 4:7408935-7408957 AATTTAACAGAGAGAAATCTTGG - Intronic
969693226 4:8718963-8718985 AATGAAACAAAGAGAAAAATAGG + Intergenic
969922586 4:10554128-10554150 AATTAAAAACAGAGACATCTGGG - Intronic
970085421 4:12340736-12340758 AATTGAACAATGAGAAAACTTGG + Intergenic
970392649 4:15631118-15631140 AATTGAACAAAGAGAACACTTGG - Intronic
970804685 4:20017004-20017026 ACTCAAACACAGTCAAAAATTGG - Intergenic
970917995 4:21358109-21358131 AATTAAACAATGACAACACTTGG + Intronic
971325831 4:25642860-25642882 AAAAAAACAAAGTCAAAACTAGG + Intergenic
971510779 4:27420843-27420865 AATTACAAACAGACATACCTTGG + Intergenic
971560076 4:28068014-28068036 AATTAAACAATGAGAACACTTGG - Intergenic
971568549 4:28178737-28178759 AATTGAACAATGAGAAAACTTGG + Intergenic
972226044 4:37013207-37013229 AATTGAACAAAGAGAACACTTGG - Intergenic
972229309 4:37052996-37053018 GCTCAAACACAGACAAAAGTAGG + Intergenic
972467814 4:39374144-39374166 AAATAAACACAGATTAAAGTAGG - Intergenic
972973122 4:44601921-44601943 AATTGAACAATGAGAAAACTTGG - Intergenic
973348261 4:49080376-49080398 AATTGAACAATGAGAAAACTTGG + Intergenic
974257266 4:59475162-59475184 AATTAGATACAGAAAAACCTGGG + Intergenic
974446933 4:61996415-61996437 AATTAAAGACAGTCAGTACTGGG - Intronic
974470733 4:62315168-62315190 AATTGAACAATGACAACACTTGG + Intergenic
974505787 4:62770265-62770287 AATGAGACCCAGAAAAAACTGGG - Intergenic
974552868 4:63402647-63402669 GATTAAACAAAAAGAAAACTTGG + Intergenic
975059745 4:69983179-69983201 AAAGAAAGACAGACAAAACCAGG - Intergenic
975068152 4:70096151-70096173 ACTTCAAGACAGGCAAAACTTGG - Intergenic
975287672 4:72639101-72639123 AATTGAACACTGAGAACACTTGG + Intergenic
975288951 4:72653754-72653776 AATAACACACACACAAGACTAGG + Intergenic
975719629 4:77237217-77237239 ATATAAACACAAACCAAACTGGG + Intronic
976141364 4:81996133-81996155 AAGTAAACACTGACAACACAGGG - Intronic
976680869 4:87754296-87754318 AATTGAACACTGAGAACACTTGG - Intergenic
977021377 4:91764912-91764934 AATTAAACAATGAGAACACTTGG + Intergenic
977511816 4:97971588-97971610 AATTAAACAATGAGAACACTTGG + Intronic
977589080 4:98806837-98806859 AATTGAACAATGAGAAAACTTGG + Intergenic
977776510 4:100927140-100927162 GTTTAAATTCAGACAAAACTGGG - Intergenic
978732392 4:112044060-112044082 AAATAAACAAACAGAAAACTAGG + Intergenic
979196853 4:117929785-117929807 ATTTAAAAACAGACTAAACTGGG - Intergenic
979557280 4:122063195-122063217 AAATAAACTCATATAAAACTAGG + Intergenic
980221462 4:129922090-129922112 CATTAAACACTGATAAAACCAGG - Intergenic
980446161 4:132910679-132910701 AATTCAACAGAAACAAAACAGGG - Intergenic
980476174 4:133320157-133320179 AAATAATCACATACAAAAATGGG - Intergenic
980503463 4:133685378-133685400 AATTGAACAATGACAACACTGGG - Intergenic
980517844 4:133888021-133888043 GCTTAAACACAGAGAAAACCTGG + Intergenic
980572872 4:134644125-134644147 AATTAAGCACAATGAAAACTTGG + Intergenic
980580626 4:134745456-134745478 ATTCAAAAACAGGCAAAACTAGG - Intergenic
980800521 4:137743254-137743276 AATGAAAAATAGTCAAAACTAGG + Intergenic
980840043 4:138247890-138247912 AAATAAAACCAAACAAAACTAGG + Intergenic
981646732 4:147006972-147006994 AAACAAAAACAGACAATACTAGG + Intergenic
982129641 4:152216735-152216757 AATGAAGCACAGAGAAAAATTGG + Intergenic
982451179 4:155553528-155553550 AATCAGACAAAGACAATACTTGG + Intergenic
983434889 4:167700397-167700419 AAAAAAACAAAGTCAAAACTGGG - Intergenic
984827749 4:183942372-183942394 AAAAAAACAAAAACAAAACTTGG + Intronic
985015691 4:185631888-185631910 AATTCATCACAGATAAAATTTGG + Intronic
985313696 4:188631653-188631675 ATTTACACGGAGACAAAACTTGG - Intergenic
986141740 5:5037170-5037192 AATTAATCACAGTAAAAAGTGGG + Intergenic
986836956 5:11649655-11649677 GGTTAAACACAGACAAATTTGGG + Intronic
986843840 5:11730000-11730022 AAATAAACGAATACAAAACTAGG - Intronic
987043399 5:14084525-14084547 AAGTAAACACACATAAAAATGGG + Intergenic
987431643 5:17842341-17842363 AATTAAAAACAGAAAAAAGCAGG - Intergenic
987714546 5:21550609-21550631 AATTGAACACTGAGAACACTTGG + Intergenic
987789701 5:22549103-22549125 AAATAAACAAACAAAAAACTAGG - Intronic
987880212 5:23734488-23734510 AATTAAACAATGAGAACACTTGG - Intergenic
988047694 5:25979451-25979473 AAATAGAAACAGACAAAAATAGG - Intergenic
988145586 5:27301922-27301944 AATTTAACAAAGAAAACACTTGG - Intergenic
988294048 5:29331356-29331378 AAGTGAACACAGACAAAAGATGG - Intergenic
988728477 5:33946839-33946861 AATTACACAAAGACAAAAAAAGG - Intronic
989254208 5:39349189-39349211 AAAAAAACACAGAAAAGACTAGG + Intronic
989307085 5:39970683-39970705 AATTAAACACACACACAACTAGG + Intergenic
989483097 5:41955551-41955573 GATAAAACACAGACAAAGCCTGG + Intergenic
989551788 5:42744207-42744229 AATTGAACACTGAGAACACTTGG + Intergenic
990151250 5:52820313-52820335 AATTAAACAATGAGAACACTTGG + Intronic
990174967 5:53097546-53097568 AATAAAATACAGGCAAAATTTGG - Intronic
991443115 5:66672161-66672183 ATTTAAACACAGACATATGTAGG + Intronic
991959247 5:72027191-72027213 AATTTAAGACAGACAAGACCAGG + Intergenic
991978165 5:72203533-72203555 AAATAAACAAAGACAAAGCAAGG - Intronic
992949285 5:81841061-81841083 TATTAAAAACAAACAAAAATAGG + Intergenic
993090421 5:83419107-83419129 AATAAAACACAGAGGAAACGGGG + Intergenic
993401362 5:87456709-87456731 AATTAAAAACAGATAAATTTTGG + Intergenic
993804672 5:92390131-92390153 AACTAAACAAAGACAAACCAGGG - Intergenic
994243255 5:97448731-97448753 AATTAAACAATGAGAACACTTGG - Intergenic
994582946 5:101670864-101670886 AGTTAAAGACACTCAAAACTGGG + Intergenic
994659193 5:102633328-102633350 AATTAAACAATGAGAACACTTGG + Intergenic
995101348 5:108311023-108311045 AATTCAACACAAATAAAATTTGG + Intronic
995407793 5:111820582-111820604 AATTGGAAAGAGACAAAACTGGG + Intronic
995601400 5:113800959-113800981 AATTTAGCAAAGACAGAACTAGG + Intergenic
995710319 5:115028582-115028604 AATCTAAGACAGAGAAAACTTGG - Intergenic
996189516 5:120521872-120521894 AATTGAACAATGAGAAAACTTGG - Intronic
996366968 5:122712864-122712886 AAATAAAAAGAGAGAAAACTGGG + Intergenic
996615561 5:125436931-125436953 AACAAAAAACAGACAAGACTTGG - Intergenic
996896269 5:128486817-128486839 AATTAAACAATGAGAACACTTGG - Intronic
997636576 5:135411794-135411816 AATTAAATAAAGCCAAAAGTAGG - Intergenic
999367109 5:151030301-151030323 AATTAAACACACACACAAATTGG + Exonic
1000824456 5:166027511-166027533 ATTTAGGCACAGACAAACCTGGG + Intergenic
1000945011 5:167411527-167411549 ACACAAACACAGACACAACTTGG - Intronic
1001416368 5:171547087-171547109 AATTAAACACTGAGAATACACGG - Intergenic
1002544210 5:179927888-179927910 AATTAAAAATAGACAAAGCTAGG - Intronic
1003339560 6:5206385-5206407 AATTACACACAGAGATAGCTAGG - Intronic
1003706211 6:8533821-8533843 AAATAAAGAGAGGCAAAACTTGG - Intergenic
1003843488 6:10147472-10147494 AATTAAACAAAAGCATAACTTGG + Intronic
1004749710 6:18549429-18549451 AATTAAACAATGAGAACACTTGG + Intergenic
1007003008 6:38332697-38332719 AAAAAAACACACACATAACTGGG + Intronic
1008567131 6:52780356-52780378 AAATCAACACAGACAATACAAGG - Intergenic
1008594664 6:53029491-53029513 AATGAAACACAGACAAACCTAGG - Intronic
1008723489 6:54387786-54387808 AATTAAATACAAACAAATGTAGG + Intronic
1008814309 6:55545070-55545092 AATGAAACAAAAACAAAACTAGG + Intronic
1008953559 6:57188359-57188381 ATTTAAAAAAAGATAAAACTAGG + Exonic
1009002181 6:57731451-57731473 AATTGAACACTGAGAACACTTGG - Intergenic
1009606726 6:65879429-65879451 AATTAAATACATTTAAAACTAGG + Intergenic
1009814988 6:68721416-68721438 AATTGAACAAAGAGAACACTTGG + Intronic
1010290262 6:74128329-74128351 AACCAAACACAGAAAAAAGTAGG - Intergenic
1011576129 6:88802048-88802070 AAATAAACACACACAAAAACAGG + Intronic
1012596000 6:101040970-101040992 AACCAAACACAGACTAAAGTGGG - Intergenic
1013074592 6:106759940-106759962 AAATAAGTACAGAGAAAACTGGG + Intergenic
1013610068 6:111786260-111786282 AATTGAACAATGAAAAAACTTGG - Intronic
1013752721 6:113425737-113425759 AATTTAATACACAGAAAACTGGG - Intergenic
1014287468 6:119516791-119516813 ACTTAAGTACAGACAAGACTGGG + Intergenic
1014541505 6:122681613-122681635 AATTAAGAAAAAACAAAACTTGG + Intronic
1014546071 6:122737363-122737385 AATTAAGAAAAGATAAAACTTGG + Intergenic
1014783926 6:125596588-125596610 AATTAAACACAGTGATAAATGGG - Intergenic
1014930314 6:127327827-127327849 AATTTAACACAGAAACAGCTGGG + Intronic
1017002821 6:150007568-150007590 AATTGAACAATGACAACACTTGG - Intergenic
1017236450 6:152121717-152121739 AAATCAATACAAACAAAACTTGG + Exonic
1017318572 6:153061739-153061761 CATTAAACACAAACATAAATGGG - Intronic
1018757716 6:166863985-166864007 GATTAAAAACAGACAAAGCCAGG + Intronic
1020512717 7:9079054-9079076 ACTTAAACACAGACAAACTTGGG - Intergenic
1022128730 7:27382358-27382380 AATTAAAAATATACAAACCTAGG - Intergenic
1022574907 7:31488077-31488099 TATTATACACAGAGAAAATTAGG - Intergenic
1022647899 7:32248536-32248558 AATTACACAAATACAAAGCTAGG + Intronic
1023382165 7:39619862-39619884 AATTAAAAAAAAACAACACTAGG - Intergenic
1023712166 7:43006497-43006519 AAGATAACACAGACAAAACGGGG + Intergenic
1024028015 7:45430773-45430795 AATTAAACCCAGAATAATCTAGG + Intergenic
1024128751 7:46327752-46327774 AATTAAAAACAGAAACAATTGGG + Intergenic
1024527607 7:50362043-50362065 AATAAAACAAAAACAAAAATAGG + Intronic
1024816968 7:53282601-53282623 AATTGAACAAAGAAAACACTTGG - Intergenic
1025720502 7:64007442-64007464 AATTGAACAGTGACAACACTTGG - Intergenic
1025963587 7:66247125-66247147 AATTAAAAACAAACAAAAAGAGG + Intronic
1026247925 7:68638702-68638724 AATTAAAAACAAACAAAAAAAGG + Intergenic
1026312426 7:69198323-69198345 AAATATACACAGACAATTCTTGG - Intergenic
1026373853 7:69730181-69730203 AAATAAAAAAAGAAAAAACTTGG - Intronic
1026643443 7:72147888-72147910 AATTGAACATTGACAACACTTGG + Intronic
1027306884 7:76907732-76907754 AATTAAACAACGAGAACACTTGG - Intergenic
1027383674 7:77639077-77639099 AATTTAAGCCAAACAAAACTTGG - Intronic
1027876335 7:83774205-83774227 AATTGAACAAAGAGAATACTTGG + Intergenic
1028300297 7:89191049-89191071 AATGCAACACAGGCAGAACTCGG - Intronic
1028343383 7:89750213-89750235 AATGAAACACACATAAAACAAGG - Intergenic
1028838894 7:95404843-95404865 AATTAAACACAGACAAAACTGGG + Intergenic
1029286827 7:99471591-99471613 AATAAAAAACAAACAAAACTTGG + Intergenic
1030042778 7:105467021-105467043 AAAAAAAAACAGAAAAAACTGGG - Intronic
1030348805 7:108460541-108460563 AGTAAAACACAGATAAAACCTGG + Intergenic
1030552716 7:110984194-110984216 AAAGAAACAGAGACAAAAATGGG + Intronic
1030687700 7:112503864-112503886 AATTTAACCAAGACAGAACTTGG - Intergenic
1031447969 7:121878070-121878092 CTTTAAACACAGAGAAAAATTGG - Intronic
1031490604 7:122383271-122383293 AATTAAACACTGAGAACACACGG + Intronic
1031554813 7:123160530-123160552 GAATAAAAAGAGACAAAACTTGG + Intronic
1031561338 7:123242449-123242471 AATTCAAAACACATAAAACTTGG + Intergenic
1031662156 7:124438697-124438719 AATTAAACTAAGACAACATTGGG + Intergenic
1032717998 7:134527346-134527368 AATTCAACACAGCCAAAAGTTGG - Intergenic
1032722620 7:134563053-134563075 AATTCAACACAGCCCAAAGTTGG - Intronic
1033007531 7:137583512-137583534 ACTTAAAAACAGACTAAATTGGG - Intronic
1033141396 7:138830293-138830315 AAAAAAACAAAAACAAAACTTGG - Intronic
1033631280 7:143160414-143160436 AATTAAACAATGAGAACACTTGG - Intergenic
1033949613 7:146768121-146768143 AATTAAATTTAGACAAAATTTGG + Intronic
1033963953 7:146950495-146950517 AATTAAACACTGAGAACACACGG - Intronic
1035238048 7:157512855-157512877 AATTAAACAATGAGAACACTTGG + Intergenic
1035450647 7:158974713-158974735 AATTAAAGAAAGAGAAACCTGGG - Intergenic
1035631641 8:1111179-1111201 AATTAAATACAAAGAAAACATGG + Intergenic
1036072409 8:5455689-5455711 AATAAAAGACAGACACCACTAGG - Intergenic
1036918194 8:12825516-12825538 AAATAAACATAGAGAAAAATTGG - Intergenic
1037375797 8:18226319-18226341 AATTAAAAACAACCAAACCTGGG + Intergenic
1037410825 8:18594621-18594643 AAGTAAACAGAGACAGGACTTGG + Intronic
1037449042 8:18998264-18998286 AATTAACCACATACAAAATCTGG + Intronic
1037545664 8:19918629-19918651 AACTAAAAACAGAACAAACTAGG + Intronic
1038203022 8:25433589-25433611 AATTAAATACAGTAAGAACTGGG + Intronic
1038370493 8:26984657-26984679 AATTAAACAAAAAAAACACTGGG + Intergenic
1038371602 8:26998751-26998773 AATTAAACCCGGAGAAAACAGGG - Intergenic
1039009601 8:33078255-33078277 AATTGAACAATGACAACACTTGG - Intergenic
1039211904 8:35226725-35226747 GAGTAAATAAAGACAAAACTAGG + Intergenic
1039635684 8:39162211-39162233 AATTGAACAACGAGAAAACTAGG - Intronic
1039636843 8:39177010-39177032 AATGAAAAACAGAAAAAAGTTGG - Intronic
1039736843 8:40341867-40341889 AGGTAAACAAAGACAAAAGTTGG + Intergenic
1040070566 8:43183836-43183858 AATTAAACAATGAGAACACTTGG - Intronic
1040274480 8:46000306-46000328 AATTGAACAATGAGAAAACTTGG - Intergenic
1041326907 8:56677447-56677469 TTTTAAACACAAACAAAAGTTGG + Intergenic
1041688038 8:60662333-60662355 ATTTAAACATACACAAAAATAGG + Intergenic
1041772391 8:61485885-61485907 AATTAAACAATGAGAACACTTGG + Intronic
1041946013 8:63443703-63443725 AATTGAACAAAGAGAACACTTGG - Intergenic
1042534908 8:69849210-69849232 AATTAAACAATGAGAACACTTGG + Intergenic
1042951596 8:74205704-74205726 ATTAAAACACACACAAAGCTGGG - Intergenic
1043146057 8:76656514-76656536 AATTGACCACAGACAAAAGTTGG + Intergenic
1043419021 8:80080257-80080279 AATAAAACCTAGACATAACTTGG - Intronic
1043497806 8:80822322-80822344 AATTAAACAATGAGAACACTTGG - Intronic
1043706012 8:83351876-83351898 AATAGATGACAGACAAAACTGGG + Intergenic
1043752073 8:83950346-83950368 AATTAAACAATGAGAACACTTGG + Intergenic
1043818515 8:84834209-84834231 AATACAACACAGCCTAAACTGGG + Intronic
1044011381 8:86998188-86998210 ACAGAAACACACACAAAACTAGG - Intronic
1044361799 8:91294427-91294449 AATTCAACACAGCCAATACTTGG - Intronic
1044815009 8:96102827-96102849 AATTGAACAATGAGAAAACTTGG - Intergenic
1044831417 8:96253529-96253551 AAGCAAACAGAGAAAAAACTAGG + Intronic
1045079422 8:98608528-98608550 ATTTTAACACAGATAAAATTTGG + Intronic
1045587346 8:103553386-103553408 AATTTAACAATGACAACACTTGG + Intronic
1046357884 8:113111535-113111557 AAATAAATACAAGCAAAACTGGG - Intronic
1046368546 8:113270765-113270787 AATTGAACAATGACAACACTTGG + Intronic
1046492498 8:114970867-114970889 AATTATAAATAGACATAACTGGG + Intergenic
1046560785 8:115834730-115834752 AAGTACACACAGAATAAACTAGG + Intergenic
1046575863 8:116028116-116028138 AAATAAACAAAGACGTAACTCGG + Intergenic
1046964112 8:120143640-120143662 AAACAAACACACAAAAAACTTGG + Intronic
1047482438 8:125297518-125297540 AATGAGACACAGTAAAAACTAGG + Intronic
1047679132 8:127235943-127235965 AATTAAACAATGAGAACACTTGG - Intergenic
1047985154 8:130225607-130225629 AAGAACACACAGACAACACTTGG + Intronic
1048839045 8:138548629-138548651 AATTAATCAAAGACATAACAGGG + Intergenic
1049785192 8:144447324-144447346 AAGGAAACACAGACAAAACATGG + Intergenic
1049875287 8:145014035-145014057 AATTAAACAATGAGAACACTTGG - Intergenic
1049889130 9:51876-51898 AATTGAACACACAAAAAAATAGG - Intergenic
1050343127 9:4660971-4660993 AATTGAACAATGACAACACTTGG + Intronic
1050517023 9:6455339-6455361 AATTGAACAATGACAACACTTGG - Intronic
1050793238 9:9501883-9501905 AAAACAACACAGAGAAAACTTGG + Intronic
1051072708 9:13191981-13192003 ATTTAAAGTCAGACAAATCTGGG - Intronic
1051134851 9:13908136-13908158 AATTGAACAATGACAACACTTGG + Intergenic
1051463500 9:17350993-17351015 AATCAAAGACAGAAAAATCTAGG + Intronic
1051594142 9:18807172-18807194 ATTTATACAGATACAAAACTTGG + Intronic
1051647781 9:19287241-19287263 AATGTAACACAGACAATATTAGG - Intronic
1051941889 9:22516592-22516614 AATAAAACACACAAAAAAATAGG - Intergenic
1051949841 9:22618337-22618359 TATTAAACACAGAAAAGACATGG - Intergenic
1052322788 9:27185956-27185978 TGTTAAACACATACAATACTTGG + Intronic
1052696282 9:31883362-31883384 AATTAAACAATGAGAACACTTGG - Intergenic
1053730616 9:41053161-41053183 AATTGAACACACAAAAAAATAGG - Intergenic
1053753816 9:41281632-41281654 AATTAAACAATGAGAATACTTGG - Intergenic
1054259339 9:62845988-62846010 AATTAAACAATGAGAATACTTGG - Intergenic
1054332438 9:63774045-63774067 AATTAAACAATGAGAATACTTGG + Intergenic
1054697883 9:68378914-68378936 AATTGAACACACAAAAAAATAGG + Intronic
1055044069 9:71907257-71907279 AAATAAACATAGATAAATCTTGG + Intronic
1056180760 9:84080108-84080130 AAATAAACACAGACAACTCCAGG - Intergenic
1056791618 9:89629007-89629029 AAATAAACACAAACAAAAAATGG + Intergenic
1056988407 9:91386906-91386928 AATCAAACAAAAACAAAGCTTGG - Intergenic
1057141999 9:92732254-92732276 AATGAAACACAGAGAAAAAAAGG + Intronic
1057188405 9:93072101-93072123 GATCTAACACAGACAACACTGGG - Intronic
1058122534 9:101154901-101154923 AATTGAACAAAGAGAACACTTGG + Intronic
1058198676 9:102010623-102010645 AATGAAAAACAGAAAAAAGTAGG + Intergenic
1058207460 9:102126592-102126614 AATTAAACAATGAGAACACTTGG - Intergenic
1058404326 9:104654807-104654829 AATATAAAACAGACAAAAGTAGG + Intergenic
1058524876 9:105847457-105847479 AAATAAACATAGAAAAAAATTGG + Intergenic
1058595478 9:106610909-106610931 AATTGAACAAAGAGAACACTTGG + Intergenic
1058726856 9:107812811-107812833 AATTAATCACACACAAAAAGGGG - Intergenic
1059956246 9:119518769-119518791 AATTGAACACTGAGAACACTTGG + Intronic
1203747364 Un_GL000218v1:48308-48330 AAATAAAAAAACACAAAACTGGG - Intergenic
1203338995 Un_KI270304v1:853-875 AGTTGAACACACACAAAACAAGG + Intergenic
1203406606 Un_KI270538v1:25178-25200 AATTAAACACACACATCACAAGG - Intergenic
1203562374 Un_KI270744v1:69493-69515 AATAAAAAAAACACAAAACTGGG + Intergenic
1185977699 X:4739876-4739898 AATTAAACAATGAGAACACTTGG - Intergenic
1186337248 X:8603505-8603527 AATTAAATACTAACAAAAGTAGG + Intronic
1186399472 X:9243466-9243488 AATTAAACACAAAAAGAAATAGG - Intergenic
1186592022 X:10940813-10940835 AATTAAACAATGAGAACACTTGG - Intergenic
1186599159 X:11018178-11018200 AATTAAACAATGAGAACACTTGG - Intergenic
1186676262 X:11820699-11820721 AATTAAACATTTACAAAAATAGG - Intergenic
1186857790 X:13642425-13642447 AATTGAACAAAGAGAACACTTGG + Intergenic
1186933277 X:14418329-14418351 AATTAAACAATGAGAACACTTGG - Intergenic
1187370170 X:18698788-18698810 AAGAAAACACACACACAACTGGG + Intronic
1188058500 X:25570520-25570542 AATTATACACAAATAAAGCTGGG - Intergenic
1188323124 X:28765093-28765115 AATTGAACAATGACAACACTTGG + Intronic
1188470706 X:30535822-30535844 AATGCAACAAAGACAAAAATTGG + Intergenic
1188483749 X:30660075-30660097 AATTAAAAACTGAAAAAACAAGG - Intronic
1189041434 X:37544845-37544867 AATTAAACAGTGAGAACACTTGG + Intronic
1189118165 X:38365276-38365298 TGTTAAACACAGATAACACTAGG + Intronic
1190438967 X:50457496-50457518 AATTAAGCACAGATAAAAACAGG - Intronic
1190478120 X:50848297-50848319 AATTAAACAATGAGAACACTTGG + Intergenic
1190967758 X:55318034-55318056 AATTAAACATTGAGAACACTTGG - Intergenic
1191177556 X:57521294-57521316 AATTAAACAATGAGAACACTTGG - Intergenic
1191595343 X:62937430-62937452 AATTGAACAAAGAGAACACTTGG - Intergenic
1192059598 X:67810497-67810519 AATAAAATACAGAGAAAACCAGG + Intergenic
1192094394 X:68195358-68195380 AAGACAACACAGACAAATCTTGG - Intronic
1192363008 X:70451086-70451108 AAAAAAACAAAGACAGAACTGGG - Intronic
1192870929 X:75183223-75183245 AATTAAACAGTGAGAACACTTGG - Intergenic
1192934386 X:75843836-75843858 AATTGAACAAAGAGAACACTTGG - Intergenic
1193371218 X:80699351-80699373 AATGAAACACACATAAACCTAGG + Intronic
1193478732 X:81999820-81999842 CAGTAAAAACAGACAAAAATGGG - Intergenic
1193578894 X:83237301-83237323 AAGAAAACACAAACAAAAGTGGG + Intergenic
1193869252 X:86776788-86776810 AATTAAACAATGAGAACACTTGG - Intronic
1194113146 X:89862424-89862446 AATTAATAACAGAAAAAAATTGG - Intergenic
1194143014 X:90228529-90228551 AATTAAACATAGACAAACATTGG - Intergenic
1194231045 X:91324086-91324108 AATTGAACAATGAGAAAACTTGG + Intergenic
1194252440 X:91592834-91592856 AATTAAACAGAGACATAAACAGG + Intergenic
1194629637 X:96268119-96268141 ATTTAAACAAAAACAAAACAGGG - Intergenic
1194822039 X:98521714-98521736 AATTCACCACAGAAATAACTTGG - Intergenic
1195982039 X:110589567-110589589 AAATAATCACAGAAAAAACATGG + Intergenic
1197172801 X:123453331-123453353 AATTGAACAAAGAGAACACTTGG + Intronic
1197260216 X:124309218-124309240 AATTAAACAAAGAGAACACTTGG - Intronic
1197465984 X:126805129-126805151 AATTTAACAAAGAGAACACTTGG + Intergenic
1197523217 X:127525773-127525795 TATTAAAAACAAACACAACTTGG + Intergenic
1198050402 X:132946557-132946579 AATTGAACAATGACAACACTTGG + Intronic
1198551045 X:137744969-137744991 AAGTAAACACAGAGAAAATCAGG - Intergenic
1198650318 X:138856275-138856297 AATTAAACACAGATACATGTAGG + Intronic
1198700983 X:139397953-139397975 AATTGAACAGAGAGAACACTTGG + Intergenic
1198783580 X:140262406-140262428 ATATATACACAGACAAAATTGGG - Intergenic
1198920161 X:141716581-141716603 AATTGAACAAAGAGAACACTTGG - Intergenic
1199183877 X:144892148-144892170 AGTGAAACAGAGACAAAATTGGG - Intergenic
1199302371 X:146228124-146228146 AATTGAACAATGACAACACTTGG - Intergenic
1199400377 X:147391762-147391784 AATTAAAAACAGAAAAAAGCAGG + Intergenic
1199747878 X:150785895-150785917 CAGAAAACACAAACAAAACTTGG - Intronic
1200465832 Y:3517480-3517502 AATTAATAACAGAAAAAAATTGG - Intergenic
1200488767 Y:3797848-3797870 AATTAAAAATAGACAAACATTGG - Intergenic
1200571371 Y:4834078-4834100 AATTAAACAGAGACATAAACAGG + Intergenic
1201160685 Y:11163303-11163325 AAATAAAAAAACACAAAACTGGG - Intergenic
1201387901 Y:13463067-13463089 AATTAAACAATGAGAACACTTGG - Intronic
1201591623 Y:15621467-15621489 AATTAAACAGTGAGAACACTTGG + Intergenic
1202269541 Y:23057856-23057878 AAGTAAACAAATACAATACTAGG + Intergenic
1202422535 Y:24691602-24691624 AAGTAAACAAATACAATACTAGG + Intergenic
1202448254 Y:24978484-24978506 AAGTAAACAAATACAATACTAGG - Intergenic