ID: 1028839504

View in Genome Browser
Species Human (GRCh38)
Location 7:95412704-95412726
Sequence GAGAGTAATCAGAAGGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028839499_1028839504 20 Left 1028839499 7:95412661-95412683 CCTGAAAATAACTGAAAAGAAGA 0: 1
1: 0
2: 9
3: 82
4: 889
Right 1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG 0: 1
1: 0
2: 1
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028839504 Original CRISPR GAGAGTAATCAGAAGGTTGG TGG Intronic
902207572 1:14880548-14880570 GGGAGGAATCAAATGGTTGGGGG + Intronic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
904406995 1:30297921-30297943 TGGAGAATTCAGAAGGTTGGAGG - Intergenic
904465861 1:30707221-30707243 GAGAGTGATGTGAAGGTGGGTGG - Intergenic
905412601 1:37781527-37781549 AAGACAAATCAGAAGATTGGAGG - Intergenic
906091411 1:43182625-43182647 AATAGTAATCAGAAGGCTGCTGG + Intronic
908515606 1:64889359-64889381 AAGAGTAATCAGAAGGTTTTTGG + Intronic
911701011 1:100951729-100951751 GGGAGAAATCAGGAGGTTGTTGG - Intronic
912102948 1:106234158-106234180 GAGGGGAAGTAGAAGGTTGGAGG + Intergenic
912603907 1:110967944-110967966 GAGAGTAAAGAAAATGTTGGAGG + Intergenic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
915518351 1:156426937-156426959 GAGAGTGATAGGAAGGCTGGGGG - Intronic
915612937 1:157009553-157009575 GAGAGCTATCCTAAGGTTGGTGG + Intronic
916116967 1:161493605-161493627 GGGAGTCAGCAGAAGGTAGGAGG + Intergenic
916282420 1:163066508-163066530 GAGAGTAATCAGATGGTGAAGGG - Intergenic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
920210246 1:204322736-204322758 GAGAGTAAACACTTGGTTGGGGG - Intronic
920434382 1:205938700-205938722 GAGAGGAAGGAGAGGGTTGGAGG - Intronic
920866660 1:209758984-209759006 GACAGTAATCAGAAGTTTCCAGG - Intronic
921731032 1:218578178-218578200 CATAGTAATCAGTAGGCTGGGGG + Intergenic
922254319 1:223879257-223879279 GAGAGAAATCAGATGGTGGCTGG - Intergenic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
923480864 1:234382099-234382121 GAGAGTTATTAGAAGTTTAGGGG + Intronic
924885978 1:248217126-248217148 GAAAAAAATCAGAAGATTGGTGG - Intergenic
1063639163 10:7813872-7813894 GAGAGCAATCAGAGGGGTGTGGG + Intergenic
1063883566 10:10554661-10554683 GAGATAACTCAGAAGGATGGAGG - Intergenic
1064943909 10:20767249-20767271 GAGAGGAACCAGAAGATTGATGG - Intergenic
1066620915 10:37348926-37348948 GAGAGTACTCAGGAGGCAGGAGG - Intronic
1069857519 10:71449745-71449767 GAGAAGGCTCAGAAGGTTGGGGG - Intronic
1070113442 10:73506693-73506715 GAGCTGAATCAGAAGGTTTGTGG + Intronic
1072935448 10:99708114-99708136 GAGAATAAATAGAAGATTGGTGG - Intronic
1078097591 11:8310225-8310247 AAGTCTAATCAGAAGGTTGTGGG + Intergenic
1078920672 11:15827234-15827256 AAGTGTAAACAGGAGGTTGGGGG - Intergenic
1079395774 11:20062074-20062096 AAAAGTATTCAGAAGGTTGAAGG + Intronic
1081120489 11:39259559-39259581 GACAGGAATCAGAGGGGTGGAGG + Intergenic
1083807041 11:65080638-65080660 GAGAGAAATCAGAAGGTCGCTGG - Intronic
1083812923 11:65115689-65115711 GAGAGTAGTCAGAGAGCTGGGGG + Intronic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1086498664 11:87429894-87429916 AGGAATAATCAGAAGGGTGGAGG + Intergenic
1088871652 11:113895365-113895387 GAGATTTATCAGCAGGTTGCAGG - Intergenic
1089177114 11:116557064-116557086 GAGAGGCATCAGAGTGTTGGGGG - Intergenic
1090180479 11:124694491-124694513 GACATTAATAAGAAGGTTGATGG - Exonic
1091956694 12:4649773-4649795 GAGAAGAATCAGGAGCTTGGTGG + Intronic
1092645706 12:10569820-10569842 GAGTCTATTCAGATGGTTGGGGG - Intergenic
1094487512 12:30936796-30936818 GAGAGTCATCAGCTTGTTGGAGG + Intronic
1095298608 12:40556257-40556279 GAGAGTAAGAATAAGGGTGGAGG + Intronic
1095698947 12:45171203-45171225 CAAAATAATCAGAAGGTTGCTGG + Intergenic
1096221650 12:49833156-49833178 GTGAGTCCTCAGAACGTTGGTGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096655333 12:53087196-53087218 GAGAGGAAGCAAAAGGTTAGAGG + Intergenic
1097032187 12:56097745-56097767 GAAAGTATTCTTAAGGTTGGGGG - Intronic
1097152946 12:56993164-56993186 GACAGGAAGCAGAAGGTTGGTGG + Intergenic
1097914086 12:65001919-65001941 GAGAATCATCAGAAGGTAAGAGG - Intergenic
1098275045 12:68804731-68804753 GAGGGTTAGGAGAAGGTTGGGGG - Intergenic
1098497469 12:71152846-71152868 GAGAGCAATTAAAAGATTGGAGG - Intronic
1101696904 12:107135266-107135288 GAGAGAAATGAGAAGGTTTATGG + Intergenic
1106451769 13:29888821-29888843 GTGAGTTATCAGAAGGAAGGAGG + Intergenic
1106909716 13:34450562-34450584 GAGAGTAAACAGGCGGGTGGTGG - Intergenic
1108461664 13:50673225-50673247 AAGAGGAATGGGAAGGTTGGGGG - Intronic
1110156608 13:72324319-72324341 GACAATATTCAGAAAGTTGGAGG - Intergenic
1110416899 13:75262835-75262857 TAGGGGAATCAGAAGTTTGGGGG - Intergenic
1111734011 13:92114531-92114553 TAGAGTAATCAGAAGATTAAAGG + Intronic
1112657481 13:101467151-101467173 GACAGTATTAAGAAGGTGGGTGG - Intronic
1113369532 13:109710306-109710328 GAGAGAAATCTGTAGGTTTGGGG - Intergenic
1114820733 14:26016267-26016289 GACAGTTATCAGAGGCTTGGAGG + Intergenic
1115360005 14:32489929-32489951 GAGAGTCAGCAAAAGGGTGGTGG + Intronic
1116641655 14:47470973-47470995 AAGTGTTATCTGAAGGTTGGTGG + Intronic
1116875683 14:50109022-50109044 AAGACAAATCAGAAGATTGGAGG - Exonic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1119179263 14:72593938-72593960 GAGGGTCATCAGAGGGGTGGGGG + Intergenic
1120145179 14:80971206-80971228 GTAAGAAATCTGAAGGTTGGGGG - Intronic
1126758431 15:51947037-51947059 AAGAGTGATCAGAAGCTTGCTGG - Intronic
1127137154 15:55936172-55936194 GAGAGTAAATACAGGGTTGGGGG - Intronic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1134565809 16:15250924-15250946 AAGAGTCATCAGAAGCTTAGAGG - Intergenic
1134736686 16:16505774-16505796 AAGAGTCATCAGAAGCTTAGAGG + Intergenic
1134866029 16:17607933-17607955 GAGAGGAATGGGAAGATTGGGGG - Intergenic
1134930831 16:18206394-18206416 AAGAGTCATCAGAAGCTTAGAGG - Intergenic
1138434100 16:56987609-56987631 GAGAGAACTCAGGAGGTGGGTGG - Intergenic
1138509860 16:57502207-57502229 GTGAGTAGTGAGAGGGTTGGTGG + Intergenic
1139730280 16:68938244-68938266 AAGAACAATGAGAAGGTTGGAGG + Intronic
1141291454 16:82721837-82721859 GAGAGTCATCAGGAGGCTGTAGG + Intronic
1141844793 16:86600679-86600701 GATAGTAATCAGAAGGATAATGG - Intergenic
1143806519 17:9432803-9432825 GAAAGTACACAGAAGGTTAGAGG - Intronic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1147162563 17:38576694-38576716 GAGAGAAATAGGAGGGTTGGAGG - Intronic
1148967989 17:51453637-51453659 GTGAGTTATCAGGAGGTTGAGGG + Intergenic
1149490445 17:57081069-57081091 GAGAATGATCAGAAGGCTGCTGG + Intergenic
1150126343 17:62637721-62637743 GAGGGTAATCAGAAGGTCACAGG - Intronic
1151596108 17:75078829-75078851 GAGTGTTCTCTGAAGGTTGGTGG + Intergenic
1156358714 18:36364894-36364916 GGGAGAAAGCAGAAGGGTGGTGG + Intronic
1157762441 18:50274656-50274678 GAGAGTTATCAAAATGTTGCTGG - Intronic
1157922992 18:51733040-51733062 GATGGTCATCAGCAGGTTGGAGG + Intergenic
1158260901 18:55604756-55604778 TGGAGTTATAAGAAGGTTGGTGG + Intronic
1160001878 18:75032496-75032518 GAGAGAAGAGAGAAGGTTGGTGG - Intronic
1160446085 18:78927856-78927878 GAGAGTATACAGAAGCCTGGGGG - Intergenic
1163524532 19:17812626-17812648 CAGACAACTCAGAAGGTTGGGGG + Exonic
1164578459 19:29419558-29419580 GAGTGGAAGCAGAAGGGTGGGGG - Intergenic
1167000927 19:46745686-46745708 GGGAGTAAGCAGAAGCTTGCCGG - Intronic
1167567340 19:50264913-50264935 GAAAGGAATGAGAAGGATGGAGG + Intronic
1167978699 19:53254716-53254738 GAGAGGAATGAGCAGGTTCGGGG + Intronic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926364586 2:12121518-12121540 GAGTGTAAACAGTAGGTTTGAGG + Intergenic
926548665 2:14273735-14273757 GTGAGTAATCAGAAAATTTGTGG - Intergenic
928220358 2:29398190-29398212 GAGAGAAATGAGAAGATGGGAGG - Intronic
928460243 2:31465742-31465764 GAGAGTAGGCAGAGGGTTAGGGG + Intergenic
928933055 2:36645459-36645481 GAGAGTAATTAGAAGGGAGGAGG + Intronic
930371573 2:50508107-50508129 GAGAGAAATCAATAGGCTGGTGG - Intronic
931066222 2:58590598-58590620 GAGAGGAGACACAAGGTTGGAGG - Intergenic
931402762 2:61946072-61946094 GAGTGTATTCAGATGGTTGTGGG + Intronic
931654578 2:64499317-64499339 GAGTGCATTCAGATGGTTGGGGG + Intergenic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
933060220 2:77727340-77727362 GTGAATAATCAGAATGTTGAGGG - Intergenic
934037497 2:88100405-88100427 TGGAGTAATCAGAAGCTTGTAGG - Intronic
935347390 2:102121247-102121269 GAGAGAAACCAGGGGGTTGGGGG - Intronic
936684776 2:114815041-114815063 GAGAGGGAGCAGAAGGGTGGAGG - Intronic
936865827 2:117075505-117075527 TATAGTAATCATAATGTTGGTGG - Intergenic
940149579 2:150584525-150584547 GAAAGAAATCAGAAGCTTGTAGG + Intergenic
940894211 2:159064759-159064781 CAGAGTAAGCAGAAGTTTTGTGG - Intronic
943361102 2:186920811-186920833 GGGAGAAATCAAGAGGTTGGGGG - Intergenic
947720331 2:232366112-232366134 GAGAGTTACCAGAAGGTCTGCGG + Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
1169128639 20:3150252-3150274 GGGAGAAAGCAGAAGGTTGAGGG + Intronic
1170366195 20:15600740-15600762 GCGAGCAATCAGCAGGTTTGTGG + Intronic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1170508922 20:17057305-17057327 GACATTAATAAGGAGGTTGGTGG + Intergenic
1171115269 20:22519898-22519920 GAGAGCTATCAGAAGGTTTCGGG + Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1175665217 20:60852876-60852898 GAGAGGAATAAGGAGGTTGTTGG + Intergenic
1176366438 21:6035730-6035752 GAGAGCAATCAGGAAGTTTGGGG - Intergenic
1177197364 21:17917510-17917532 GAGAGTAACAAGAAGGTGGAAGG + Intronic
1177940075 21:27399254-27399276 TAGAGTACTCAGAAGCTTAGAGG + Intergenic
1178007831 21:28242733-28242755 GGGAGTCATCAGAAGGTCAGAGG + Intergenic
1178315924 21:31566793-31566815 GAGAGTAAACACATGGTTTGAGG - Intergenic
1178357019 21:31918037-31918059 GACAGTAATCAGAGGTTTGCAGG - Intronic
1179258467 21:39737974-39737996 GAGAGTACGCAGAAGGGTGATGG + Intergenic
1179757079 21:43502815-43502837 GAGAGCAATCAGGAAGTTTGGGG + Intergenic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1181330384 22:22086416-22086438 GCGTGTCATCAGAAGGCTGGGGG + Intergenic
1182727766 22:32461453-32461475 ATGAGTGATCTGAAGGTTGGAGG + Intronic
1182862803 22:33574991-33575013 GAGAGGCATCAGAACCTTGGAGG + Intronic
1182990724 22:34764806-34764828 GAGTGTCATAAGAAGGTTGTAGG - Intergenic
1183774285 22:39953148-39953170 CAGAGTCATCAGAAAGTGGGTGG - Intronic
951464132 3:22983748-22983770 AAAAGAAACCAGAAGGTTGGAGG + Intergenic
951730913 3:25809153-25809175 AAGAGTAATCAGTAGTGTGGAGG - Intergenic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
956362574 3:68464741-68464763 GAGAATAAACTGAAGGTAGGAGG + Intronic
957305215 3:78449216-78449238 GAGTTTATTCAGATGGTTGGAGG - Intergenic
959311695 3:104745955-104745977 GAGAGTAATGGGAAGGAAGGGGG + Intergenic
959390696 3:105769904-105769926 GAGACTAATCAGAAGGTTGTTGG + Intronic
959660546 3:108863380-108863402 GAGAGTAAGCAGAAGACTTGGGG - Intergenic
960781749 3:121327315-121327337 CAGAGTAATCAACAGTTTGGTGG - Intronic
964005646 3:151824425-151824447 GAGAGTAAACAAAAGGTTTCTGG + Intronic
965075639 3:163971552-163971574 GAGACTAAACAGTAGTTTGGTGG - Intergenic
966374948 3:179286852-179286874 CAGAGAAATGAGAAAGTTGGGGG + Intergenic
967527393 3:190510589-190510611 TAGAGGAAGCAGAAGGTTTGTGG + Intergenic
971136823 4:23877972-23877994 GAAAGTAATCACAAGGTTCAGGG - Intronic
972556771 4:40189376-40189398 GAAAGGACTCAGAAGGGTGGAGG + Intergenic
973811895 4:54579366-54579388 GATAGTAATCAGAAGAGTTGTGG + Intergenic
978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG + Intergenic
982352692 4:154433252-154433274 GAGAGTCCCCAGAAGCTTGGAGG + Intronic
983694552 4:170511931-170511953 GAGAGAAAACAGAACTTTGGTGG + Intergenic
984681382 4:182613625-182613647 GAGAGTGTTAAGAAGATTGGGGG - Intronic
984743087 4:183186507-183186529 AAGAAGAATCAGAAGGTTTGAGG + Intronic
985370233 4:189278987-189279009 GGGAGTCATCAGAGGGTGGGTGG + Intergenic
988199150 5:28048156-28048178 GAGAGTTACCCGAAGCTTGGCGG - Intergenic
990756924 5:59082851-59082873 TAGAGTCATCAGAAGGTTCCAGG - Intronic
991405081 5:66293672-66293694 GAGAGCACTCAGATGGTGGGGGG - Intergenic
991919575 5:71642279-71642301 GGGAGGAATGAGAAGGTGGGAGG + Intronic
992769411 5:80033576-80033598 GAGAGCAATAAGAAGGTAGAAGG - Intronic
994495162 5:100502721-100502743 GAGAGAAATCAAAAGATTGTTGG + Intergenic
994985030 5:106921696-106921718 GGGAGCAATCAGCAGGTTGAAGG - Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
999135250 5:149314404-149314426 GAGGGTAACTAGAATGTTGGGGG + Intronic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
1000366857 5:160499898-160499920 AAGGCAAATCAGAAGGTTGGTGG + Intergenic
1001788296 5:174432688-174432710 GAGAGGGATCAGAGGGTTGGAGG + Intergenic
1002831121 6:822185-822207 GCGTGAAATCAGAAGGCTGGAGG + Intergenic
1003166363 6:3682411-3682433 GAGAGGAACCAGAAGACTGGAGG - Intergenic
1004005927 6:11637173-11637195 GAGAGTTGCCAGAAGCTTGGAGG + Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007670368 6:43547699-43547721 GACAGCACTCTGAAGGTTGGAGG + Exonic
1010182642 6:73105903-73105925 GAAAATAATCAGAAGCTTGGGGG - Intronic
1013158954 6:107522869-107522891 GTGATTAATCAGAATGTGGGAGG + Intronic
1015570407 6:134615234-134615256 GAGCATAATCTGAGGGTTGGGGG + Intergenic
1016359922 6:143256333-143256355 GAGAGAAAACAAGAGGTTGGAGG - Intronic
1018383776 6:163284709-163284731 GAGAGGCATCAGAAGGGAGGCGG - Intronic
1018480076 6:164181276-164181298 GGGTCTATTCAGAAGGTTGGGGG - Intergenic
1018815135 6:167324941-167324963 GAGAGAACTCTGAAGCTTGGAGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1022840664 7:34161045-34161067 GAGACGAAGCTGAAGGTTGGAGG - Intergenic
1023600814 7:41880277-41880299 GGGAGAAACCAGAAGGTCGGGGG + Intergenic
1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG + Intronic
1030957150 7:115868391-115868413 GTGAGTAACCAGAAGTCTGGGGG + Intergenic
1031930942 7:127685380-127685402 GTTAGTAGTGAGAAGGTTGGAGG - Intronic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1035978595 8:4341884-4341906 ATGAGTAATCAGAAAGTTAGTGG - Intronic
1037535843 8:19823506-19823528 GAGAATAATCAGAACATTGAGGG - Intronic
1039432316 8:37534585-37534607 GAGAGTAACAAGAATGGTGGAGG + Intergenic
1043063675 8:75538874-75538896 CAGAGTATTCATAAGGTTTGTGG + Intronic
1043077156 8:75716314-75716336 GACAGTAATCAGAAGCTCTGTGG + Intergenic
1044712226 8:95069001-95069023 GAAAGCAATCAGAGGGATGGAGG - Intronic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1047353928 8:124102241-124102263 GAGTCTATTCAGATGGTTGGGGG + Intronic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048196336 8:132334884-132334906 GAGAGAAGTCAGAAGTGTGGGGG - Intronic
1048224718 8:132574193-132574215 GTCAGTCATCATAAGGTTGGTGG + Intronic
1048790868 8:138102089-138102111 GAGGTAAATCAGAAGGATGGAGG + Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1054357527 9:64076314-64076336 GAGAGCAATCAGAAATTTGCAGG + Intergenic
1055739556 9:79371608-79371630 GAGAGTGATTAGCAGGATGGTGG - Intergenic
1057501257 9:95598230-95598252 GAGACTTATCAGAAGGCTGAAGG + Intergenic
1058465429 9:105222286-105222308 GAGAGAAATCAGACTATTGGGGG - Intergenic
1060423594 9:123486767-123486789 GAGGGTGCCCAGAAGGTTGGGGG - Intronic
1061163779 9:128911006-128911028 GGGAGGACTCAGCAGGTTGGTGG - Intronic
1062707045 9:137951517-137951539 GAGAGAAACCAGGAGGGTGGTGG - Intronic
1186404118 X:9286651-9286673 AACAGTAATAATAAGGTTGGGGG + Intergenic
1186950016 X:14614198-14614220 GAGAGTAATGGGAAAGATGGAGG + Intronic
1187458855 X:19467344-19467366 GCGAGGAATAAGAATGTTGGTGG - Intronic
1187581555 X:20612685-20612707 GGGAGGACTCAGATGGTTGGGGG + Intergenic
1188437970 X:30184596-30184618 GAGAATAATTAGTAGGATGGAGG + Intergenic
1189170046 X:38900465-38900487 GGTTGTAATCAGAATGTTGGTGG + Intergenic
1190041626 X:47077024-47077046 CAGAGTGCTCAGGAGGTTGGTGG + Intergenic
1190175472 X:48145570-48145592 GAGTCTATTCAGATGGTTGGGGG - Intergenic
1191202960 X:57804209-57804231 AAGCTTATTCAGAAGGTTGGGGG + Intergenic
1194287681 X:92030628-92030650 GAGAGTAGTTCGAGGGTTGGGGG - Intronic
1195387209 X:104324568-104324590 GGAAGTAACCAGGAGGTTGGTGG - Intergenic
1195675997 X:107507398-107507420 GAGGGGAATCAGAAGCTGGGAGG + Intergenic
1196099424 X:111832007-111832029 GAGAGTAATAAGGAGATTGAGGG + Intronic
1196551520 X:117032201-117032223 GATAGTGTTCAGAAGGTTTGTGG - Intergenic
1200605215 Y:5255188-5255210 GAGAGTAGTTCGAGGGTTGGGGG - Intronic
1201449498 Y:14095816-14095838 GAAAGTAATCGGTAGCTTGGTGG + Intergenic