ID: 1028845308

View in Genome Browser
Species Human (GRCh38)
Location 7:95473419-95473441
Sequence AACCTGTGGCTCTCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028845308_1028845312 16 Left 1028845308 7:95473419-95473441 CCTGGCTGTGAGAGCCACAGGTT No data
Right 1028845312 7:95473458-95473480 AAGCAGTGATGAGTTCCCAGCGG No data
1028845308_1028845315 28 Left 1028845308 7:95473419-95473441 CCTGGCTGTGAGAGCCACAGGTT No data
Right 1028845315 7:95473470-95473492 GTTCCCAGCGGAGCCTGGCTGGG No data
1028845308_1028845314 27 Left 1028845308 7:95473419-95473441 CCTGGCTGTGAGAGCCACAGGTT No data
Right 1028845314 7:95473469-95473491 AGTTCCCAGCGGAGCCTGGCTGG No data
1028845308_1028845313 23 Left 1028845308 7:95473419-95473441 CCTGGCTGTGAGAGCCACAGGTT No data
Right 1028845313 7:95473465-95473487 GATGAGTTCCCAGCGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028845308 Original CRISPR AACCTGTGGCTCTCACAGCC AGG (reversed) Intergenic
No off target data available for this crispr