ID: 1028845313

View in Genome Browser
Species Human (GRCh38)
Location 7:95473465-95473487
Sequence GATGAGTTCCCAGCGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028845308_1028845313 23 Left 1028845308 7:95473419-95473441 CCTGGCTGTGAGAGCCACAGGTT No data
Right 1028845313 7:95473465-95473487 GATGAGTTCCCAGCGGAGCCTGG No data
1028845311_1028845313 -3 Left 1028845311 7:95473445-95473467 CCAGGACAATAACAAGCAGTGAT No data
Right 1028845313 7:95473465-95473487 GATGAGTTCCCAGCGGAGCCTGG No data
1028845310_1028845313 9 Left 1028845310 7:95473433-95473455 CCACAGGTTTATCCAGGACAATA No data
Right 1028845313 7:95473465-95473487 GATGAGTTCCCAGCGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028845313 Original CRISPR GATGAGTTCCCAGCGGAGCC TGG Intergenic
No off target data available for this crispr