ID: 1028850055

View in Genome Browser
Species Human (GRCh38)
Location 7:95527942-95527964
Sequence GGCCAGGGGGGTCTCCATGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 318}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028850055_1028850068 14 Left 1028850055 7:95527942-95527964 CCCACATGGAGACCCCCCTGGCC 0: 1
1: 0
2: 6
3: 32
4: 318
Right 1028850068 7:95527979-95528001 GGCCCTCCGCTTTAAGGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 82
1028850055_1028850063 -7 Left 1028850055 7:95527942-95527964 CCCACATGGAGACCCCCCTGGCC 0: 1
1: 0
2: 6
3: 32
4: 318
Right 1028850063 7:95527958-95527980 CCTGGCCATCGCCGCCTACTGGG 0: 1
1: 0
2: 0
3: 5
4: 96
1028850055_1028850072 26 Left 1028850055 7:95527942-95527964 CCCACATGGAGACCCCCCTGGCC 0: 1
1: 0
2: 6
3: 32
4: 318
Right 1028850072 7:95527991-95528013 TAAGGAGCAGGAGTACAGCACGG 0: 1
1: 0
2: 0
3: 23
4: 284
1028850055_1028850061 -8 Left 1028850055 7:95527942-95527964 CCCACATGGAGACCCCCCTGGCC 0: 1
1: 0
2: 6
3: 32
4: 318
Right 1028850061 7:95527957-95527979 CCCTGGCCATCGCCGCCTACTGG 0: 1
1: 0
2: 0
3: 11
4: 91
1028850055_1028850067 8 Left 1028850055 7:95527942-95527964 CCCACATGGAGACCCCCCTGGCC 0: 1
1: 0
2: 6
3: 32
4: 318
Right 1028850067 7:95527973-95527995 CTACTGGGCCCTCCGCTTTAAGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028850055 Original CRISPR GGCCAGGGGGGTCTCCATGT GGG (reversed) Exonic
900294810 1:1943519-1943541 GGCCTGCGGGGTTTCCATGACGG - Intronic
900406773 1:2496229-2496251 GTCCAAGGGGGCCTCCGTGTCGG - Intronic
900493754 1:2966760-2966782 AGCCAGGGAGGTCTCCAAGCTGG + Intergenic
900531356 1:3155046-3155068 CTCCAGGGGGTGCTCCATGTGGG + Intronic
900906391 1:5562651-5562673 GCCCAGTGGGGACTCCGTGTGGG + Intergenic
900919483 1:5661587-5661609 GGCCAGGGAGGACTCCGTGAAGG - Intergenic
901034534 1:6328472-6328494 GGCCAGGGGTTTCACCATGTTGG - Intronic
901482912 1:9538517-9538539 GGCCAGGAAAGTCTCCATCTGGG + Intergenic
902219730 1:14957357-14957379 AGGCAGGGGCCTCTCCATGTTGG + Intronic
903767337 1:25743300-25743322 GGCTGGGGCGGGCTCCATGTTGG - Intronic
904244507 1:29177466-29177488 AGACAGGGGTTTCTCCATGTTGG + Intronic
904959042 1:34316497-34316519 CCCCAGGGGGGACTCTATGTGGG - Intergenic
905295177 1:36949763-36949785 AGACAGGGGGGTCACCATGTTGG + Intronic
905570467 1:39000534-39000556 AGACAGGGGTTTCTCCATGTTGG + Intronic
906058789 1:42935208-42935230 CTCCAGGGTGGTCTCCATGGTGG - Intronic
906412750 1:45592320-45592342 GGCCAGGGTGGTCTCCAACCTGG + Intronic
908398725 1:63750260-63750282 GGTCAGGGGTTTCACCATGTTGG - Intergenic
908782781 1:67706844-67706866 AGACAGGGGTTTCTCCATGTTGG + Intronic
910701680 1:90081891-90081913 GGTCAGGGTGGTGACCATGTAGG - Intergenic
911205330 1:95086653-95086675 GGCACGGGGTTTCTCCATGTTGG - Intergenic
912273136 1:108230108-108230130 GGGCAGTGGCATCTCCATGTTGG - Intronic
912295084 1:108464214-108464236 GGGCAGTGGCATCTCCATGTTGG + Intronic
912344873 1:108955038-108955060 GGTCAGGGATTTCTCCATGTTGG + Intronic
912379405 1:109239263-109239285 GCCCAGGCGGGTCTGCCTGTGGG - Intergenic
915530409 1:156499739-156499761 GGCCAGGGAGTTCTCCAGTTGGG + Intronic
915581710 1:156816691-156816713 GGCCAGGGGGAACTCCATGAGGG + Exonic
916356666 1:163917385-163917407 AGCCAGGGGAGTCTTCTTGTGGG - Intergenic
916952027 1:169790370-169790392 GACAAGGGGTTTCTCCATGTTGG + Intronic
918341266 1:183569774-183569796 GGACAGGGGTTTCACCATGTTGG + Intronic
918378095 1:183929161-183929183 AGCCAGGGGGACCTCCATGGAGG + Intergenic
918683303 1:187382701-187382723 AGCCAGGATGGTCTCCATCTTGG + Intergenic
920138100 1:203786954-203786976 AGACGGGGGGTTCTCCATGTTGG - Intergenic
922182044 1:223243170-223243192 GTCCTGTGGTGTCTCCATGTGGG - Intronic
922305534 1:224340977-224340999 GGCCAGGCGGGGCTCCCCGTCGG - Intergenic
923951847 1:238964527-238964549 GAGAGGGGGGGTCTCCATGTTGG + Intergenic
923982312 1:239338865-239338887 GGCCAGGGCGGTCTCAGTGAAGG - Intergenic
1063160462 10:3414692-3414714 TGCCACTGGGGTCTCCATGCTGG - Intergenic
1063419225 10:5897990-5898012 TACCAGGGAGGTCTCCCTGTGGG + Intronic
1064210750 10:13358829-13358851 AGACAGGGGTTTCTCCATGTTGG + Intergenic
1064637898 10:17387451-17387473 GGGGGGGGGGTTCTCCATGTTGG + Intronic
1067080253 10:43208651-43208673 CCCCAGGTGGGTCTCCAGGTAGG - Intronic
1070772878 10:79092517-79092539 GGCTAGGGGTGTCCCCCTGTGGG + Intronic
1070805294 10:79267170-79267192 GGCCTGGGGTGTCTGGATGTGGG + Intronic
1071552643 10:86578952-86578974 AGACAGGGGGTTCACCATGTTGG + Intergenic
1072071693 10:91924073-91924095 GGCCATGGCGGTCTCCAGGTGGG + Exonic
1073028177 10:100503618-100503640 AGACAGGGGTTTCTCCATGTTGG + Intronic
1073100861 10:101005865-101005887 TGGGAGGGGGGTCTCCTTGTTGG + Intronic
1075145136 10:119876308-119876330 GGCCAGGGGAGTGTTCATGAAGG + Intronic
1076484502 10:130807395-130807417 GGCCAGGGGGGAGGGCATGTTGG + Intergenic
1076880815 10:133238265-133238287 GGCCGGGGGCGTTTCCATGAGGG + Intronic
1077342125 11:2030865-2030887 TGCCAGGGGGGTCTCCAGGTGGG + Intergenic
1077395146 11:2316873-2316895 GCAAAGGGGGGTCCCCATGTGGG - Intronic
1078282842 11:9919916-9919938 AGACAGGGGTTTCTCCATGTTGG + Intronic
1080966197 11:37217596-37217618 CCCCAGTGGGGGCTCCATGTGGG + Intergenic
1081329737 11:41788544-41788566 GGCCAGCTGGGGCTCCAGGTGGG - Intergenic
1081525962 11:43928039-43928061 GGCCAGGGAAGTCTGCCTGTTGG + Intronic
1081581011 11:44351854-44351876 GGCCAAAGGGATCTCCATGGGGG + Intergenic
1082952575 11:58833032-58833054 GGCCAGGTTGGTCTCCATCTCGG + Intergenic
1083585712 11:63857365-63857387 GGTCAGGCTGGTCTCCATGTTGG + Intronic
1083760224 11:64811910-64811932 AGACAGGGGTGTCACCATGTTGG + Intergenic
1083817445 11:65143465-65143487 GGCCAGGATGGTCACCATGTTGG + Intergenic
1083854865 11:65387976-65387998 AGACAGGGGTTTCTCCATGTTGG - Intronic
1083894514 11:65613479-65613501 GGCCAGGTGGGTGGCCAGGTGGG - Exonic
1084523029 11:69675987-69676009 GGCCAGGAGGCTCTGCATGTGGG + Intergenic
1084549309 11:69831391-69831413 TGCAAGTGGGGTCTCCAGGTGGG - Intergenic
1087400986 11:97667124-97667146 GGCCAGGGGGAGTTCCAGGTGGG + Intergenic
1089562885 11:119354077-119354099 AGACGGGGGTGTCTCCATGTTGG - Intergenic
1090421776 11:126580335-126580357 GGCCAGGGAGGTCTTCGTGGAGG + Intronic
1090859818 11:130643063-130643085 GGTGAGGAGGGTCTCCATGCAGG - Intergenic
1202825111 11_KI270721v1_random:86054-86076 TGCCAGGGGGGTCTCCAGGTGGG + Intergenic
1092254767 12:6920584-6920606 AGACAGGGGTTTCTCCATGTTGG + Intronic
1094305677 12:29016678-29016700 GCCCAGAGGGCTTTCCATGTAGG + Intergenic
1095573167 12:43705448-43705470 GGCCGTGGGAATCTCCATGTTGG - Intergenic
1096827493 12:54291024-54291046 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1099839007 12:87942586-87942608 GGCCAGGGGGATGTCCAAGGCGG + Intergenic
1101369932 12:104117591-104117613 AGACGGGGGGTTCTCCATGTTGG + Exonic
1102318296 12:111908157-111908179 GACAAGGGGTTTCTCCATGTTGG - Intergenic
1103649427 12:122422017-122422039 GGCCAGGGTGCCCTCCATGCCGG + Intronic
1103800263 12:123533476-123533498 GGCCAGGAGGGTGGCCATGGAGG - Exonic
1103927213 12:124429669-124429691 GGGCAGTGGGCTGTCCATGTCGG - Exonic
1104076117 12:125391577-125391599 GGCCATGGGAGCCACCATGTGGG + Intronic
1104410293 12:128552020-128552042 GTTCAGGGGGGACTCCGTGTTGG + Intronic
1104471986 12:129036711-129036733 GGCCAGTCTGGTCTCCATGTTGG - Intergenic
1106547617 13:30744199-30744221 GGGCAGGGGGGCCTCCTTCTAGG + Intronic
1113372369 13:109734767-109734789 AGTCAGGGGGTTCACCATGTTGG - Intergenic
1114420453 14:22578065-22578087 GACAAGGGGTTTCTCCATGTTGG - Intronic
1114632167 14:24166025-24166047 GGCAAAGGGGGTCTCCCAGTGGG + Intronic
1115767973 14:36643417-36643439 GGCCAGGGGTTTCACCATGTTGG - Intergenic
1116415503 14:44672646-44672668 CCCCAGTGGGGACTCCATGTTGG + Intergenic
1121586250 14:95064885-95064907 GGCAAAGGATGTCTCCATGTGGG + Intergenic
1121807412 14:96841669-96841691 GGCTAGGGGTTTCACCATGTTGG - Intronic
1122745153 14:103893289-103893311 AGACAGGGGTTTCTCCATGTTGG + Intergenic
1122885464 14:104708547-104708569 GGCCCGGGGGGCCACCATGGTGG - Exonic
1123025368 14:105421361-105421383 TGGAAGGGGGGTCTCCAGGTGGG - Intronic
1123144240 14:106112541-106112563 AGTCAGGTGTGTCTCCATGTGGG - Intergenic
1123192223 14:106582422-106582444 AGTCAGGTGTGTCTCCATGTGGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1123816656 15:23986630-23986652 GACCTGGGGTTTCTCCATGTTGG + Intergenic
1124014715 15:25864838-25864860 GGCCTCGGGGGTCACCAGGTGGG - Intronic
1124033185 15:26029836-26029858 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1124346735 15:28927955-28927977 AGACAGGGGTTTCTCCATGTTGG - Intronic
1126334446 15:47570854-47570876 GGCCAGGGGTGTCTCAGTGATGG + Intronic
1127166857 15:56252727-56252749 AGCCCGGGGGATCTCCATGAGGG - Intronic
1127419052 15:58787178-58787200 GGCCAGAGGTGTCACCATGTTGG + Intronic
1128031330 15:64483278-64483300 GGAGACGGGGTTCTCCATGTTGG + Intronic
1128157985 15:65403849-65403871 GGATAGGGAGGTCTCCATGGGGG + Intronic
1129246274 15:74280794-74280816 GGGCAGGGGGCTCACCATGATGG - Exonic
1129348400 15:74938877-74938899 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1129521587 15:76189753-76189775 AACCAGGGGGCTCTGCATGTGGG + Intronic
1129545823 15:76393854-76393876 AGCCAGGGGTCTTTCCATGTGGG - Intronic
1129718403 15:77864905-77864927 GGGCAGGTGGGGCTCCATGGAGG - Intergenic
1129749082 15:78047812-78047834 GGGCAGGGGGTGCTCAATGTTGG + Intronic
1129843717 15:78758751-78758773 GGCCAGGGAGGTCCCCATGGGGG + Intergenic
1130983865 15:88831867-88831889 GGCCAGGAATGTCTCCATGGAGG + Intronic
1132386003 15:101400331-101400353 GGCCAGGGGTGTGTGCATGATGG - Intronic
1132715989 16:1290028-1290050 AGCCAGGGGGGTCTCCACAGGGG - Intergenic
1132948085 16:2543662-2543684 AGCCACAGGGGTTTCCATGTAGG - Intronic
1132966362 16:2657680-2657702 AGCCACAGGGGTTTCCATGTAGG + Intergenic
1132983167 16:2749571-2749593 GGCCAGGGGGGTCTGGAGGAAGG + Intergenic
1133296224 16:4753791-4753813 GGCCAGATGGCTCTCCACGTGGG - Intronic
1135001994 16:18784430-18784452 AGACACGGGGTTCTCCATGTTGG + Intronic
1136029556 16:27492763-27492785 GGCCGCAGGGGTCTGCATGTGGG + Intronic
1136581363 16:31153140-31153162 GCCCAGGGGTTTCTCCATGTTGG + Intergenic
1138976511 16:62214387-62214409 GGCCATAGGGGTCACCATGCCGG + Intergenic
1139604091 16:68005558-68005580 AGACAGGGGTTTCTCCATGTTGG + Intronic
1140437403 16:74958874-74958896 AGTCAGGGGTTTCTCCATGTTGG - Intronic
1140488882 16:75317452-75317474 GGCCAGGGGGCTCTCCAAGGAGG + Intronic
1140899177 16:79352338-79352360 GGGCACTTGGGTCTCCATGTTGG + Intergenic
1141428618 16:83959369-83959391 GGCCCCGGGGGTCTCCATCCTGG + Exonic
1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG + Intergenic
1142825818 17:2509703-2509725 GGCCAGGATGGTCTCCATGTTGG - Intronic
1143452108 17:7042506-7042528 GGGCTGGGGGGTCTCCAGGAAGG + Exonic
1144408580 17:14976600-14976622 GGGCAGTGGGGTCTCCACGGAGG + Intergenic
1144790485 17:17855700-17855722 GGACAGGTGGGTTTCCTTGTGGG - Intronic
1145058026 17:19715891-19715913 AGTCGGGGGGTTCTCCATGTTGG + Intronic
1145119678 17:20246469-20246491 GGCCAGGGGTGCCTCCAAGAGGG - Intronic
1145177508 17:20713707-20713729 AGGCAGGTGGGTCACCATGTTGG - Intergenic
1146080281 17:29773854-29773876 GGCATGGGGTTTCTCCATGTTGG + Intronic
1146886875 17:36476814-36476836 GGCCAAGGGGGTATCATTGTTGG + Intergenic
1146990948 17:37271781-37271803 GGCCAGGGGTTTCACCATGTTGG - Intronic
1147446324 17:40477395-40477417 GGCCCGGGGGGTCTGGATGATGG + Exonic
1147555702 17:41477637-41477659 GGCCAGCTGGGCCTCCACGTTGG + Exonic
1148127807 17:45245850-45245872 GGCCAAGGCAGTCTCCATGAGGG - Intronic
1148529129 17:48372489-48372511 AGACAGGGGTTTCTCCATGTTGG + Intronic
1148789104 17:50163243-50163265 GCCCAGGGGTTTCACCATGTTGG - Intergenic
1149295748 17:55260801-55260823 AGCGACGGGGTTCTCCATGTTGG - Intergenic
1149693788 17:58600347-58600369 GGCCATGGTGGTCACCATGTTGG - Intronic
1150133034 17:62679672-62679694 GGCCTGGGGCCTCTCCATCTGGG - Intronic
1152795446 17:82304121-82304143 GCCCAGGGGTGTCTCCAAGCAGG + Intergenic
1152972231 18:173607-173629 GGTCAGACTGGTCTCCATGTTGG + Intronic
1153685248 18:7538597-7538619 GCCCAGTGGGGACTCCGTGTGGG + Intergenic
1155144950 18:23075753-23075775 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1157275645 18:46309556-46309578 GGCCAGGCTGGTCTCCATGTTGG + Intergenic
1157523396 18:48360857-48360879 GGAAAGGGAGGTCTCCTTGTGGG + Intronic
1157862565 18:51154134-51154156 GGCCAAGGGGCTTTCCCTGTGGG - Intergenic
1158941391 18:62408556-62408578 GGGAAGGGGTTTCTCCATGTTGG + Intergenic
1159996602 18:74970811-74970833 CCCCAGTGGGGACTCCATGTGGG + Intronic
1160364623 18:78313635-78313657 TGCCTGTGGGGTCCCCATGTAGG - Intergenic
1160669705 19:355046-355068 AGACAGGGGTTTCTCCATGTTGG + Intergenic
1160927063 19:1551760-1551782 GGCCAGGGGTGTCACCATGCTGG - Intergenic
1161191660 19:2960729-2960751 GGCCAGGCTGATCACCATGTTGG + Intergenic
1161320597 19:3639056-3639078 GGCGCGGGGAGTCTCCGTGTGGG - Intronic
1161410206 19:4112761-4112783 GGCCTGTGGGGTCACCATGAGGG - Intronic
1161824944 19:6557084-6557106 AGACAGGGGCCTCTCCATGTTGG + Intergenic
1161865318 19:6828730-6828752 GGCCAGGGGTGTGGCCACGTGGG + Intronic
1162034378 19:7931438-7931460 TTCCAGGGGGGTCCCCCTGTGGG - Intronic
1162052543 19:8043396-8043418 GGACAGGGGTTTCACCATGTTGG + Intronic
1162812228 19:13171207-13171229 GGCCTGTGGTTTCTCCATGTGGG + Intergenic
1163546071 19:17942211-17942233 GGCCAGGGAGGGGTTCATGTTGG - Intronic
1164245662 19:23426216-23426238 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1164286570 19:23822473-23822495 GTCCTGGGGGTTCTCCGTGTAGG + Intronic
1164760591 19:30725677-30725699 GGCCATGGGGATGCCCATGTTGG - Intergenic
1166328553 19:42065820-42065842 GGTCTGGGGGGTCTCCCTGCAGG - Intronic
1166363120 19:42263902-42263924 AGCCAGGATGGTCTCCATCTTGG - Intergenic
1166378399 19:42341785-42341807 GGCCAGAGGGGTCACCAGGGAGG + Intronic
1168391358 19:56010556-56010578 GACATGGGGTGTCTCCATGTTGG - Intronic
1168569793 19:57456991-57457013 GGCCAGGATGGTCTCCATCTTGG - Exonic
925505257 2:4555095-4555117 GGCCAGGAGGGTGACCATGCGGG + Intergenic
925730209 2:6914718-6914740 AGACAGGGGTTTCTCCATGTTGG + Intergenic
926073746 2:9923490-9923512 AGACAGGGGTTTCTCCATGTTGG - Intronic
926352780 2:12012014-12012036 GGCCAGGTGGGTCAACTTGTGGG - Intergenic
927999992 2:27515460-27515482 GGCCAGGGGTGTCACCATGTTGG + Intronic
929871780 2:45765345-45765367 GGCCAATGGAGTCTCCAGGTTGG + Intronic
929944605 2:46361009-46361031 ATCCAGGGGGATGTCCATGTGGG - Exonic
932172754 2:69572429-69572451 AGACAGGGGTTTCTCCATGTTGG - Intronic
933750636 2:85600453-85600475 GGCCCGGGGGGCCCCCATTTTGG + Intronic
933796940 2:85927364-85927386 GGCCAGGGGTGTGCCCATGGTGG - Intergenic
933897903 2:86827414-86827436 GGCCAGGCTGGTCTCAATCTGGG - Intronic
934067598 2:88354047-88354069 GGCACGGGGTTTCTCCATGTTGG - Intergenic
936763837 2:115819805-115819827 AGACAGGGGTTTCTCCATGTTGG - Intronic
937110005 2:119358388-119358410 GGACAGGGGTTCCTCCATGTTGG - Intronic
937361034 2:121230356-121230378 AGACAGGGGTTTCTCCATGTTGG + Intronic
938066250 2:128283501-128283523 AGCCAGGGAGGTGTCCATGGAGG + Intronic
938290110 2:130144562-130144584 GGCCACGCGGGTCTCCCTCTGGG + Intronic
938466419 2:131528383-131528405 GGCCACGCGGGTCTCCCTCTGGG - Intronic
938721615 2:134072027-134072049 GACGAGGGGTGTCACCATGTTGG + Intergenic
940105651 2:150096863-150096885 GTCCAGGATGGTCTCCATGCTGG - Intergenic
940484119 2:154275683-154275705 GTCCAGGGGGGACTCTGTGTGGG - Intronic
940485230 2:154288937-154288959 GCCCAGGGGGGACTCTGTGTGGG + Intronic
944429183 2:199615022-199615044 AGGCAGGGGTTTCTCCATGTTGG - Intergenic
944875581 2:203961375-203961397 GGCCAGGTGGGCCACCATGAAGG - Exonic
945774002 2:214081954-214081976 GGCCAGAAGTGTCTCCATGGTGG - Intronic
946002766 2:216496597-216496619 GGGGAGGTGGTTCTCCATGTGGG + Intergenic
946846428 2:223862815-223862837 AGACAGGGGTTTCTCCATGTTGG + Intronic
947789450 2:232855777-232855799 GGGCAGGGGGGTTACCATGGAGG - Intronic
948288883 2:236809352-236809374 GGCCAGGGGTCTCTCCATCCTGG + Intergenic
949028793 2:241778572-241778594 GCCCATGGGGGTCACCATGCCGG + Intronic
1170587014 20:17742489-17742511 GGTCAGGGGAGGCTCCTTGTTGG + Intergenic
1171947352 20:31390190-31390212 GGCCAGGGTGGTATCCTGGTGGG - Intronic
1172008997 20:31835600-31835622 GGGCAGGGGAGGCTCCATCTGGG + Intergenic
1172643956 20:36458411-36458433 GGCGAGGGGTTTCACCATGTTGG + Intronic
1172668413 20:36616840-36616862 GGCCAGGGTGGTCTCGAACTGGG - Intronic
1172810831 20:37646940-37646962 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1173604393 20:44320726-44320748 GGCCAGGGGTTTCACCATGTCGG - Intergenic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174614697 20:51826756-51826778 GACAAGGGGTTTCTCCATGTTGG - Intergenic
1175724599 20:61309228-61309250 GGCTAGGGGGCTGTCCCTGTAGG + Intronic
1177236106 21:18391711-18391733 GCCCAGGGGGGACTCTGTGTGGG + Intronic
1180091348 21:45535165-45535187 GGGCCGGGGGGTCTCCCTGGAGG + Intronic
1181474360 22:23159261-23159283 GGCCAGGGCTGTCACCATGGTGG + Intronic
1181694243 22:24585040-24585062 GGCCCTGGGGGTCCCCGTGTGGG - Intronic
1181695577 22:24591263-24591285 GGGAAGGGGTTTCTCCATGTTGG + Intronic
1183183040 22:36274239-36274261 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1183332323 22:37228288-37228310 GCCCTGAGGGGTCTTCATGTGGG - Intronic
1183418071 22:37694065-37694087 AGACAGGGGTTTCTCCATGTTGG - Intronic
1184050759 22:42002394-42002416 GGACAGGGGTTTCACCATGTTGG - Intronic
1184102406 22:42347731-42347753 GGGCAGAGGGGGCTCCACGTGGG + Intergenic
1184486455 22:44782982-44783004 GGCCACGGGGGTTTCCAGGATGG + Intronic
1184591044 22:45483474-45483496 GGTCAGGGAGGGCTCCAGGTGGG + Intergenic
1184785289 22:46668603-46668625 CGCCAGGAGGGCCTCCAGGTCGG - Intronic
1185130477 22:49035933-49035955 GGCCTGAGGGGGCTCCATGCTGG - Intergenic
1185175309 22:49323017-49323039 GGCCACGGGGCCCTCCCTGTGGG + Intergenic
1185409735 22:50675220-50675242 GGGCAGGGGCGTGTCCAGGTTGG - Intergenic
950094691 3:10322019-10322041 GCCTAGGGGGGTCTCCTTGATGG - Intergenic
950858484 3:16127126-16127148 GGCCAGGGAGGGCTTCATGGAGG - Intergenic
951635274 3:24767679-24767701 GGCCATGGGAATCGCCATGTTGG - Intergenic
952221359 3:31327195-31327217 CCCCAGTGGGGACTCCATGTGGG + Intergenic
953678934 3:45025501-45025523 GGCAAGGAGGGGATCCATGTGGG - Intronic
954484592 3:50836209-50836231 CCCCGGGGGGGACTCCATGTGGG + Intronic
954718364 3:52538645-52538667 GACATGGGGTGTCTCCATGTTGG + Intronic
956439109 3:69262643-69262665 GAGCTGGGGTGTCTCCATGTTGG + Intronic
958967573 3:100576124-100576146 GACAAGGGGTTTCTCCATGTTGG - Intronic
961689477 3:128658318-128658340 GGACATGTTGGTCTCCATGTTGG - Intronic
961716042 3:128858147-128858169 GGCTTGGGGCTTCTCCATGTAGG + Intergenic
963136215 3:141907432-141907454 GGCCAGGGGTTTCACCATGTTGG - Intronic
964926434 3:161963791-161963813 CCCCAGTGGGGTCTCCATGTGGG - Intergenic
965922419 3:173933477-173933499 GGCCAGAGGGGTATCTATCTTGG + Intronic
966193125 3:177289124-177289146 AGATAGGGGTGTCTCCATGTTGG + Intergenic
966456970 3:180128252-180128274 GGCCATGGGAATCACCATGTTGG + Intergenic
968006161 3:195244573-195244595 AGACAGGGGTTTCTCCATGTTGG - Intronic
968599557 4:1502562-1502584 GGCCAGGGGCGTCCCCACCTGGG + Intergenic
974843421 4:67323548-67323570 CCCCTGTGGGGTCTCCATGTGGG - Intergenic
975132566 4:70843578-70843600 AGAGAGGGGGTTCTCCATGTTGG - Intergenic
975689292 4:76949179-76949201 GGCCTGGAGGGCCCCCATGTGGG + Intergenic
977811553 4:101361309-101361331 GGGCCGGGGTTTCTCCATGTTGG - Intergenic
978255991 4:106693647-106693669 CCCCAGTGGGGACTCCATGTGGG - Intergenic
978490586 4:109307377-109307399 AGACAGGGGTTTCTCCATGTTGG + Intergenic
980117361 4:128692284-128692306 AGACAGGGGTTTCTCCATGTTGG + Intergenic
981205229 4:142033114-142033136 GGCCATGTGGGTCTCCAAGGAGG + Intronic
981403398 4:144339910-144339932 GTCCAGGGGAATCGCCATGTTGG + Intergenic
984597651 4:181689137-181689159 AGGCAGGGGGTTCTGCATGTGGG - Intergenic
984615073 4:181888215-181888237 AGCCAGGGGTTTCCCCATGTTGG + Intergenic
985705183 5:1396404-1396426 TGGCAGGGGGGCCTCCTTGTTGG - Intronic
985965837 5:3338343-3338365 GGCCACGGTGGTCTCCACCTGGG - Intergenic
987252300 5:16112142-16112164 CCCCAGTGGGGACTCCATGTGGG - Intronic
987321321 5:16772317-16772339 AGACAGGGGGTTCTCCATGTTGG + Intronic
989042769 5:37246717-37246739 GGCTAGGGGTTTCACCATGTTGG - Intronic
989506410 5:42231126-42231148 GGCCAGGCTGTTTTCCATGTGGG - Intergenic
989604754 5:43233125-43233147 GGCCAGGCTGGTGTCCAGGTTGG - Intronic
991643709 5:68779463-68779485 GGCCAGGGGTTTCACTATGTTGG - Intergenic
992417628 5:76566885-76566907 GGCCAGGAAGGTTTCCATGGTGG + Intronic
993036998 5:82769471-82769493 GCCCAGTGGGGTCTCTATGTGGG - Intergenic
993307421 5:86289853-86289875 GGGCAGTGGCATCTCCATGTTGG + Intergenic
994212115 5:97099079-97099101 AGACAGGGAGGTCTCCATCTGGG - Intronic
995701398 5:114939373-114939395 TCCCAGTGGGGACTCCATGTCGG - Intergenic
997146783 5:131443127-131443149 AGACAGGGGTTTCTCCATGTTGG + Intronic
997492810 5:134293204-134293226 GGCACGGGGTTTCTCCATGTTGG + Intronic
998872426 5:146565967-146565989 AGCCAGGGGTGTGTCCTTGTTGG + Intergenic
1000570335 5:162904988-162905010 GGCCAGGCTGGTCTCGAAGTCGG + Intergenic
1002359987 5:178662646-178662668 GGTCAGGGAGGTCTCCATGTTGG + Intergenic
1002366951 5:178720524-178720546 GGCCACGGAGATCTCCAAGTTGG + Intronic
1002591493 5:180293663-180293685 GGCCAAGGGGGACACCATGCTGG - Intergenic
1003227976 6:4223585-4223607 CTCCAGGAGGGACTCCATGTGGG - Intergenic
1005113667 6:22313577-22313599 CCCCAGTGGGGACTCCATGTGGG + Intergenic
1005389505 6:25318786-25318808 GTCCTGGGGGGTCTGGATGTCGG + Intronic
1005432699 6:25775141-25775163 AGACAGGGGGTTCACCATGTTGG - Intronic
1005632715 6:27723510-27723532 AGACAGGGGTTTCTCCATGTTGG + Intergenic
1007021523 6:38526464-38526486 CCCCAGTGGGGACTCCATGTAGG - Intronic
1008939405 6:57030180-57030202 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1010536638 6:77038813-77038835 CCCCAGTGGGGACTCCATGTAGG - Intergenic
1011407397 6:87030595-87030617 GGCCTGGTGGGTCTTCATATGGG - Intergenic
1012217004 6:96599379-96599401 GAGCAGGGGTTTCTCCATGTTGG + Intronic
1013596089 6:111662300-111662322 GGCCAGAGGGAACTCCAAGTGGG + Intronic
1016957493 6:149640754-149640776 GGCCAGGTTGGTCTCGATCTTGG + Intronic
1018558624 6:165076268-165076290 GGACAGGAGCGTCTCCATGAAGG + Intergenic
1021094579 7:16521146-16521168 TGCCATGTGGGTCTCCCTGTAGG + Intronic
1023479115 7:40613815-40613837 GGTCAGGCTGGTCTCCATGTTGG + Intronic
1023692993 7:42811502-42811524 AGTCAGGGGCTTCTCCATGTTGG - Intergenic
1024148588 7:46543469-46543491 GGCCACAGGGGTCTCCCTGAGGG + Intergenic
1024215956 7:47248169-47248191 GGCCTTGGTGGTCTCCCTGTGGG - Intergenic
1025875217 7:65475548-65475570 GGACAGAGGGGCCACCATGTTGG - Intergenic
1026038376 7:66845902-66845924 GGCCATGGGGGGCTGCATTTGGG + Intergenic
1027392605 7:77720372-77720394 GACCCGGGGTTTCTCCATGTTGG - Intronic
1028243536 7:88449371-88449393 GGCCATGGGAATCACCATGTTGG + Intergenic
1028850055 7:95527942-95527964 GGCCAGGGGGGTCTCCATGTGGG - Exonic
1031300896 7:120059999-120060021 GGCCTGGGGCTTCTCCATGTAGG + Intergenic
1032366791 7:131307346-131307368 CCCCAGTGGGGACTCCATGTGGG - Intronic
1032782576 7:135175989-135176011 GGCCTGGGGCTTCTCCGTGTAGG - Intergenic
1033109828 7:138564100-138564122 GGCCTGGGTCTTCTCCATGTAGG + Intronic
1034624048 7:152478901-152478923 AGACAGGGGTTTCTCCATGTTGG + Intergenic
1034643190 7:152621142-152621164 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1035642469 8:1194432-1194454 GCCCAGGGCGGCCTCCAGGTGGG + Intergenic
1039559633 8:38502328-38502350 GCCCAGCGGCGTCTCCATGGTGG + Intergenic
1040846808 8:51851834-51851856 GGCACGGGGTTTCTCCATGTTGG + Intronic
1042855787 8:73265884-73265906 GGAAAGAGGGGTGTCCATGTTGG - Intergenic
1043440191 8:80269991-80270013 AGACGGGGGGTTCTCCATGTTGG - Intergenic
1043565870 8:81546845-81546867 AGACAGGAGGCTCTCCATGTTGG - Intergenic
1047250318 8:123177415-123177437 GGCAAAGAGGGTGTCCATGTGGG - Intergenic
1047276609 8:123410471-123410493 AGACAGGGGTTTCTCCATGTTGG + Intronic
1047384849 8:124399419-124399441 GGCATGGGGTTTCTCCATGTTGG - Intergenic
1049201258 8:141341660-141341682 GGGCAGGAGGGTCTCCAGGGTGG + Intergenic
1049217157 8:141413435-141413457 GGCCAGGGCAGGCTTCATGTGGG + Intronic
1049828330 8:144684867-144684889 GGACATGGGCGTCTCCAGGTGGG - Intergenic
1049909274 9:249812-249834 GGCAAGGGGTTTCACCATGTTGG + Intronic
1051219885 9:14837057-14837079 GGCCAAGGGAATCGCCATGTTGG - Intronic
1051243556 9:15085182-15085204 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1051283458 9:15467932-15467954 GGCACGGGGTTTCTCCATGTTGG - Intronic
1052295664 9:26894018-26894040 GACAAGGGGTTTCTCCATGTTGG + Intergenic
1055331634 9:75190046-75190068 AGACAGGGGTTTCTCCATGTTGG - Intergenic
1058434241 9:104947746-104947768 AGACAGGGGTTTCTCCATGTTGG + Intergenic
1061843791 9:133375783-133375805 GGGCGGGGGGGTCCCCCTGTGGG + Intronic
1062123753 9:134848486-134848508 GGCCAGGGGCGTCTGCATTCGGG + Intergenic
1062599880 9:137314937-137314959 GGACACGGGCGTCTGCATGTGGG + Intronic
1062718534 9:138023163-138023185 GTCCAGGTGCGTCTTCATGTCGG - Exonic
1187942505 X:24395495-24395517 GGACGGGGGTTTCTCCATGTTGG + Intergenic
1188871465 X:35378569-35378591 GGCCAGGCTGGTCTCCAGGCTGG + Intergenic
1189129626 X:38484965-38484987 GGCCAGGGCGGCTTCCATGGCGG + Intronic
1189670053 X:43398779-43398801 AGACAGGGGTTTCTCCATGTTGG + Intergenic
1190218005 X:48492967-48492989 GGACGGGGGTCTCTCCATGTTGG - Intergenic
1190707254 X:53040421-53040443 AGACAGGGGTTTCTCCATGTTGG + Intergenic
1191877410 X:65810335-65810357 GGCCAGACTGTTCTCCATGTAGG + Intergenic
1193485198 X:82078674-82078696 GGCCAGTGGGGACTCTGTGTGGG + Intergenic
1194296171 X:92129202-92129224 AGACAGGGGCTTCTCCATGTTGG - Intronic
1194841698 X:98752044-98752066 CCCCAGTGGGGACTCCATGTGGG + Intergenic
1197211756 X:123833889-123833911 GGCGGGGGGGTTCGCCATGTTGG + Intergenic
1198933438 X:141883055-141883077 GGAGAGAGGAGTCTCCATGTGGG + Intronic
1200115376 X:153767651-153767673 GGCGAGGGGGACCTCCACGTAGG - Exonic
1200162005 X:154014415-154014437 GGCCTGGCTGGTCTCCAAGTAGG + Intronic
1200238419 X:154480474-154480496 GGCCGGGGGTTTCACCATGTTGG - Intergenic
1200613677 Y:5353809-5353831 AGACAGGGGCTTCTCCATGTTGG - Intronic
1201425063 Y:13840979-13841001 GACAAGGGGTTTCTCCATGTTGG + Intergenic
1201858930 Y:18573952-18573974 GGCCTGGGGCTTCTCCATGTAGG + Intronic
1201874392 Y:18746429-18746451 GGCCTGGGGCTTCTCCATGTAGG - Intronic
1202168160 Y:22014280-22014302 GGCCAGGGGCTTCTTCATGTAGG - Intergenic
1202223201 Y:22572088-22572110 GGCCAGGGGCTTCTTCATGTAGG + Intergenic
1202319914 Y:23623572-23623594 GGCCAGGGGCTTCTTCATGTAGG - Intergenic
1202550854 Y:26046484-26046506 GGCCAGGGGCTTCTTCATGTAGG + Intergenic