ID: 1028850758

View in Genome Browser
Species Human (GRCh38)
Location 7:95534629-95534651
Sequence TCTCCTCTGTGGGTTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028850753_1028850758 5 Left 1028850753 7:95534601-95534623 CCACTCTCTGCCCTCGATGCACT 0: 1
1: 0
2: 0
3: 21
4: 232
Right 1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG No data
1028850752_1028850758 8 Left 1028850752 7:95534598-95534620 CCTCCACTCTCTGCCCTCGATGC 0: 1
1: 0
2: 1
3: 22
4: 286
Right 1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG No data
1028850748_1028850758 20 Left 1028850748 7:95534586-95534608 CCATTAGCCTCCCCTCCACTCTC 0: 1
1: 0
2: 1
3: 108
4: 1533
Right 1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG No data
1028850747_1028850758 21 Left 1028850747 7:95534585-95534607 CCCATTAGCCTCCCCTCCACTCT No data
Right 1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG No data
1028850754_1028850758 -5 Left 1028850754 7:95534611-95534633 CCCTCGATGCACTTGTCTTCTCC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG No data
1028850751_1028850758 9 Left 1028850751 7:95534597-95534619 CCCTCCACTCTCTGCCCTCGATG 0: 1
1: 0
2: 3
3: 30
4: 280
Right 1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG No data
1028850749_1028850758 13 Left 1028850749 7:95534593-95534615 CCTCCCCTCCACTCTCTGCCCTC 0: 2
1: 3
2: 31
3: 304
4: 2518
Right 1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG No data
1028850755_1028850758 -6 Left 1028850755 7:95534612-95534634 CCTCGATGCACTTGTCTTCTCCT No data
Right 1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG No data
1028850750_1028850758 10 Left 1028850750 7:95534596-95534618 CCCCTCCACTCTCTGCCCTCGAT No data
Right 1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028850758 Original CRISPR TCTCCTCTGTGGGTTGCTGA TGG Intronic