ID: 1028852409

View in Genome Browser
Species Human (GRCh38)
Location 7:95552218-95552240
Sequence ACCAATCAGCAGGATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028852409_1028852419 14 Left 1028852409 7:95552218-95552240 CCCACCCCATCCTGCTGATTGGT No data
Right 1028852419 7:95552255-95552277 TGTTTTGACAGGGCGCTGATTGG 0: 352
1: 742
2: 681
3: 760
4: 950
1028852409_1028852418 4 Left 1028852409 7:95552218-95552240 CCCACCCCATCCTGCTGATTGGT No data
Right 1028852418 7:95552245-95552267 CCAAGTGGTCTGTTTTGACAGGG 0: 87
1: 453
2: 325
3: 485
4: 606
1028852409_1028852416 3 Left 1028852409 7:95552218-95552240 CCCACCCCATCCTGCTGATTGGT No data
Right 1028852416 7:95552244-95552266 GCCAAGTGGTCTGTTTTGACAGG 0: 83
1: 444
2: 324
3: 506
4: 661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028852409 Original CRISPR ACCAATCAGCAGGATGGGGT GGG (reversed) Intergenic
No off target data available for this crispr