ID: 1028855617

View in Genome Browser
Species Human (GRCh38)
Location 7:95589273-95589295
Sequence CTGTGGGGGTGGAGGTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 376}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028855605_1028855617 25 Left 1028855605 7:95589225-95589247 CCTACAGGAATTCTGGACCTGAA 0: 1
1: 1
2: 7
3: 28
4: 201
Right 1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG 0: 1
1: 0
2: 3
3: 36
4: 376
1028855607_1028855617 8 Left 1028855607 7:95589242-95589264 CCTGAACTGCTGAGTTAGGAGTA 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG 0: 1
1: 0
2: 3
3: 36
4: 376
1028855604_1028855617 28 Left 1028855604 7:95589222-95589244 CCACCTACAGGAATTCTGGACCT 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG 0: 1
1: 0
2: 3
3: 36
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028855617 Original CRISPR CTGTGGGGGTGGAGGTAACA AGG Intronic
900358420 1:2275877-2275899 CTGGTGGGGTGGAGGCAACGGGG - Intronic
900407782 1:2500022-2500044 CTGTAGGGGTGGAGGCTGCAAGG - Intronic
900589394 1:3453064-3453086 GTGTGGGGTTGGGGGTAACTTGG + Intergenic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902286532 1:15411279-15411301 GGGTAGGGGTGGGGGTAACAGGG - Intronic
903047161 1:20573437-20573459 ATGTGGGGGTGAGGGAAACAAGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904339964 1:29828260-29828282 GAGTGGGGGTGGAGGTTCCAGGG + Intergenic
904400276 1:30252271-30252293 CCGATGGGGTGGAGGTAGCACGG + Intergenic
905180112 1:36160315-36160337 CTGGGAGGGTGTAGGGAACATGG + Intronic
905263679 1:36736589-36736611 CTGGGGGAGGGGAGGTGACAAGG + Intergenic
905860874 1:41350201-41350223 CTGGGGCGGTGGAAGTCACAAGG + Intergenic
908868270 1:68576737-68576759 CTGAGGGTGTGGAAGTACCAGGG - Intergenic
909781969 1:79558854-79558876 CTGTGGTGGTGGTGGTCACATGG + Intergenic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
911265825 1:95742499-95742521 CTGTTCCGGTGGAGGTAGCAGGG + Intergenic
911554141 1:99322264-99322286 TACTGGAGGTGGAGGTAACAGGG + Intergenic
911651656 1:100395963-100395985 GACTAGGGGTGGAGGTAACAGGG - Intronic
911780570 1:101870734-101870756 CTGTGGGGGTGTAGGCAGAAAGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913438005 1:118867281-118867303 TTGTGGGGGTGGTGGTAAAGAGG - Intergenic
915226924 1:154418484-154418506 ATGTGGGGGAGGAGGGAGCAGGG + Intronic
915574701 1:156767917-156767939 CTGAGGGGGCGGAGGCAGCAAGG - Exonic
917172260 1:172190155-172190177 CGGTGGGGGTGCAGGGAAAAGGG - Intronic
917896675 1:179496804-179496826 GTATGGGGGAGGAGGTAAAAAGG - Intronic
918429454 1:184443872-184443894 CTGCTGGGGAGGAGGTAAGAAGG + Intronic
920385538 1:205568599-205568621 CTGTGGCAGTGGAGGAAACCCGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923563083 1:235056348-235056370 TTGTGGGGGTGGTGGTTTCATGG + Intergenic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924421599 1:243915016-243915038 CTGTGGGGGCTGAGGGACCAAGG - Intergenic
924490767 1:244535525-244535547 CTGTGGTGGTGGTGGCCACAGGG - Intronic
1062833182 10:619639-619661 CTGTGTGGGTGAGGGTAACCAGG - Intronic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1066373136 10:34834454-34834476 CTGTGGGGTTGTGGGAAACAGGG + Intergenic
1066507074 10:36056608-36056630 CTGCCGTGTTGGAGGTAACATGG + Intergenic
1067058221 10:43064612-43064634 GTGTGGGGGTGGGGGTCACCGGG + Intergenic
1069993657 10:72329644-72329666 ATGTGGTGGAGGGGGTAACAGGG - Intergenic
1070258266 10:74828315-74828337 GTTTGGGGTTGGAGGTACCAAGG + Intronic
1070759351 10:79014089-79014111 CTTTGGAGGTGGTGGTAGCAGGG - Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073453177 10:103621535-103621557 CTGTGAGGGTGGGGGTCACTGGG + Intronic
1073700913 10:105925683-105925705 CTGTGCTGGTGGAGGTGGCAGGG - Intergenic
1074100864 10:110354044-110354066 CTGGGGGGGTGGATGAGACAAGG + Intergenic
1075277247 10:121105280-121105302 CTATGGGGGTGGAATTAGCAGGG - Intergenic
1076048003 10:127310266-127310288 CTGTAGGGGTGGGGGTAAGGGGG - Intronic
1076371010 10:129953685-129953707 CTGTAGGGGTGGTGGGAGCAGGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076461334 10:130649472-130649494 CTGGGTGGATGGAGGTATCATGG - Intergenic
1077054005 11:581377-581399 CTGTGGCGGTGGATGTGACACGG + Intronic
1077175583 11:1188606-1188628 CTGTGCTGGTGGTGGTAACAGGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077869519 11:6250313-6250335 CTGTGGGGGAGTAGCTAACTGGG - Intergenic
1077870862 11:6260225-6260247 CTGTGGGGGTGAAGGTGTGAGGG - Intronic
1077965000 11:7120369-7120391 CTGTGGGGCTGGAGCTAAAAAGG + Intergenic
1081717120 11:45258316-45258338 CAGTGGGGGTGGAGGTGCAAAGG - Intronic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1083196563 11:61091940-61091962 CTGTGGGGGTGGGGGCACCCAGG - Intergenic
1084095166 11:66906603-66906625 CTGGGGGGATGGAGGTGACGTGG - Intronic
1084763075 11:71286426-71286448 CTGTGGGTGGGGATGTAAAACGG - Intergenic
1085753505 11:79184543-79184565 GTGTGGGGGTGGAGGTTAGGGGG + Intronic
1086151789 11:83619658-83619680 TTGTGGAGGTGGAAGTATCATGG + Intronic
1089952854 11:122546367-122546389 CTGTTCTGGTGGAGGTGACAAGG + Intergenic
1090764253 11:129863266-129863288 CAGTGGGGGTGCAAGGAACAGGG - Intergenic
1090950806 11:131471616-131471638 CATTGGAGGTTGAGGTAACAAGG + Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1091356396 11:134941036-134941058 CTGTGGGGGGGGGGGGACCAGGG + Intergenic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1092875171 12:12841672-12841694 CCGAGGAGGTGGAGGTTACAGGG - Intergenic
1093588564 12:20872152-20872174 CTGTGGTGGTGGTGGACACAGGG - Intronic
1093991161 12:25591384-25591406 CTGTGGTGGTGGTGGCCACAGGG + Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1095053723 12:37576864-37576886 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1097052172 12:56230217-56230239 CTGCGGGGGGAGAGGAAACAAGG - Intronic
1098400831 12:70073772-70073794 CTGTGAGGGTAAAGGAAACAAGG + Intergenic
1099542923 12:83936586-83936608 CTGTGGAGGCTCAGGTAACATGG - Intergenic
1102846965 12:116195261-116195283 TGGTGGGGGTGGGGGCAACAGGG + Intronic
1102973332 12:117188983-117189005 GAGTGGGGGTGGAGGGAGCAGGG - Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1104953887 12:132454500-132454522 GTGTGGGGGTTGAGGGAACGGGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1108332791 13:49407296-49407318 CTGAGGTGGAGGAGGTAACTTGG - Intronic
1109308051 13:60662168-60662190 CTGGGGGGGTGGGGGTGGCAGGG - Intergenic
1109846801 13:68003921-68003943 TTGTGAGGGGGGAGGTAAGAAGG - Intergenic
1110281550 13:73699514-73699536 CTATGAGGGTGAAGGTCACATGG + Intronic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1113411725 13:110095898-110095920 ATATGGGGGTGTAGGTAAAAGGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1117023917 14:51600565-51600587 CTGTGGGGGTGTAGGTACAAAGG - Intronic
1117160155 14:52981587-52981609 ATGTGGGGGTGGAGGGTATATGG - Intergenic
1117607163 14:57441428-57441450 CTGTGGGTGGGGAGGTAATCAGG + Intergenic
1119912018 14:78358189-78358211 CTGTAGGGGTGGTGGTAATGAGG + Intronic
1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG + Intergenic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1121871414 14:97411499-97411521 CTGTGTGGTTAGAGCTAACATGG + Intergenic
1122136348 14:99635140-99635162 CTGCAGGGGTGGAGGTCCCAGGG + Intergenic
1122280903 14:100621978-100622000 CTGTGGGGGGTGTGGTCACACGG - Intergenic
1122606033 14:102948192-102948214 GGGTGGGCGTGGAGGTGACAGGG + Intronic
1122695743 14:103551229-103551251 CTGTGGGGGTGGAGGCGGCCTGG + Intergenic
1122917148 14:104864621-104864643 CTGTGGGCGTCCAGGTAAGACGG + Intergenic
1123696846 15:22884750-22884772 CTGTGGGGGTGGAGCCATCATGG - Intronic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1128087823 15:64897917-64897939 CTGTGGAGCTGGAGCCAACAGGG - Intronic
1128632681 15:69281975-69281997 CTGTGGGTGTGGGGTTATCAGGG - Intergenic
1128803580 15:70513888-70513910 AGCTGGGGGTGGAGGTAATAAGG - Intergenic
1128814907 15:70601334-70601356 GTGTGGGGGTGGAGGTTATCTGG + Intergenic
1129324726 15:74794091-74794113 CTGTGGGGGTGGGGGTGGCGGGG - Intronic
1129324783 15:74794256-74794278 CTGTGGGGGTGGGGGTGGCGGGG - Intronic
1129324804 15:74794311-74794333 CTGTGGGGGTGGGGGTGGCGGGG - Intronic
1129684166 15:77675872-77675894 GAGTGGGGATGGGGGTAACAGGG - Intronic
1129875619 15:78973613-78973635 CTGGGGTGGTGGGGGCAACATGG + Intronic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133819965 16:9227265-9227287 CTGCGGGGGTGGGGGTAAAATGG + Intergenic
1135510803 16:23081432-23081454 CTGAGGAGGCGGAGGTATCAGGG - Intronic
1135901645 16:26465176-26465198 CAGTGGAGGTGGAGGTGGCAGGG - Intergenic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1137610275 16:49813219-49813241 CTGTGGGGTTGGAGTCACCAAGG - Intronic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138468015 16:57207966-57207988 CTGGAGGTGTGGAGGTAAAAAGG - Intronic
1139758645 16:69166254-69166276 AGGTGGGGGTGGAAGGAACATGG + Intronic
1140749145 16:78007680-78007702 CTGGGGAGGTGGAGGTTGCAGGG - Intergenic
1141227317 16:82130181-82130203 CTGTGGTGGCGGAGGCCACAGGG - Intergenic
1142144417 16:88486989-88487011 CTGTGAGGGTGGAGGAAATCAGG - Intronic
1142562688 17:820201-820223 CTGTGATGATGGTGGTAACATGG + Intronic
1142707106 17:1702423-1702445 CTCAGGAGGTGGAGGTTACAGGG - Intergenic
1143304133 17:5932739-5932761 CTGTGGGGCATGAGGTAACCAGG + Intronic
1143585546 17:7848633-7848655 CTGAGAGGGTGGAGGGAACTTGG - Exonic
1143681013 17:8476070-8476092 TTGTGGGGGTGGCGGTACGATGG + Intronic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1144145053 17:12389294-12389316 CTGTGAGGGAGCAGGGAACAGGG + Intergenic
1144216298 17:13058468-13058490 CTGTGGGCTTGGAGGCACCATGG + Intergenic
1145059260 17:19722037-19722059 AGGTGGGGGTGGAGGTCACGAGG + Intergenic
1145374255 17:22332896-22332918 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1145871240 17:28275169-28275191 CGCTGGGGGTGGAGGTGGCAAGG + Intergenic
1148349697 17:46931647-46931669 CGCTGGGGGTGGAGGTGGCAAGG - Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1149513017 17:57258038-57258060 CAGGGAGGGTGGAGGTAACTTGG - Intronic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1150893708 17:69184484-69184506 CTGTTCTGGTGGAGGTAGCAGGG - Intronic
1151223145 17:72628377-72628399 CAGTGGGGGTGGTGGGAGCAGGG + Intergenic
1151419061 17:73985558-73985580 CTGTGAGGATGGGGGTCACATGG + Intergenic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1153071860 18:1115583-1115605 CTGCTGTGGTGGAGGTAGCAGGG + Intergenic
1155019485 18:21882152-21882174 ATGTGGGGGAGGAGGTAAATGGG + Intergenic
1156064597 18:33124991-33125013 GTGTGCAGGTGGAGGTAAGAGGG - Intronic
1157163476 18:45336582-45336604 CTGTTGGCGATGAGGTAACAGGG - Intronic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1157453868 18:47809153-47809175 CTGGGGAGGTGGAGGTCAAAGGG + Exonic
1157616471 18:48990492-48990514 CTGTGGGGCTGGATGGAGCAGGG - Intergenic
1158471848 18:57743954-57743976 GTGTGATGGTGGAGGTAATAAGG - Intronic
1159022556 18:63155498-63155520 CTGCTGGGGTGGAGGCCACAGGG + Intronic
1161403429 19:4078812-4078834 CTGTGGGGGTGCTGGGGACAGGG - Intergenic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162962441 19:14136132-14136154 CAGTGGGGGAGGAGGTCACGGGG + Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1166118105 19:40667843-40667865 GTGTGGGGGTGGCAGGAACACGG + Exonic
1166145666 19:40833190-40833212 CTGTGGAGGAAGATGTAACATGG + Intronic
1166149775 19:40864092-40864114 CTGTGGAGGAAGATGTAACATGG + Intronic
1166744110 19:45131900-45131922 CTGTGGGGTCGCAGGCAACAAGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
927128543 2:20036404-20036426 CTGTGGGAGTGGATATCACATGG - Intronic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
927784746 2:25965910-25965932 CTGTGGGGGTGGAAAAGACAGGG + Intronic
928077535 2:28278831-28278853 CTGGGGAGGTGCAGGTGACAAGG + Intronic
930101491 2:47606974-47606996 GGCTGGGGGAGGAGGTAACAGGG - Intergenic
930574247 2:53126960-53126982 CTGTTCTGGTGGAGGTAGCAGGG + Intergenic
931277931 2:60760533-60760555 CTGAGGGGGTAGAGGTTTCAGGG + Intronic
931849257 2:66236295-66236317 CTGAGGGGGGGGGGGTAAAAGGG + Intergenic
932485487 2:72081959-72081981 GTGTGGGGGTGGGGGCAGCAGGG - Intergenic
932784881 2:74591513-74591535 CTGTGGTGGGGGAGGGAGCAGGG + Intronic
933161227 2:79026844-79026866 ATGTGGGGTTGGAGGTGATAGGG + Intronic
933689979 2:85172306-85172328 GTGTGGGGGTGGTGGCCACAGGG - Intronic
934527795 2:95062365-95062387 CAGTGGGGGTGGATGTGACTGGG - Intergenic
936729369 2:115361514-115361536 ATGAGGGGGTGCAGGAAACAGGG - Intronic
937226262 2:120371762-120371784 CTGGGGGGTGGGAGGAAACAGGG - Intergenic
938671293 2:133588975-133588997 CAGTGGTTGTGGAGGTCACATGG + Intergenic
939857292 2:147374650-147374672 TTGTGGGGTTTGAGGCAACAGGG - Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
943230826 2:185248923-185248945 CTGGGGAGGTAGAGGTTACAGGG + Intergenic
943532704 2:189104714-189104736 CTGTGGGGGTGGGGGTAAAGTGG - Intronic
944931666 2:204526487-204526509 CTGTGAGGTTGGAGGTAAGGTGG - Intergenic
946018082 2:216620189-216620211 GGGTGAGGGTGGGGGTAACAGGG + Intergenic
946307085 2:218862126-218862148 GAGTGGGGGAGGAGGTGACACGG + Intronic
946327144 2:218990604-218990626 ATGAGGGGGTGGAGGAAATAAGG - Intronic
948153848 2:235765266-235765288 CCGTGGGGGTGGGGGTATCTGGG + Intronic
948525810 2:238570166-238570188 CAGTGGGGGAGGAGGTCCCAGGG + Intergenic
948528366 2:238587424-238587446 CTGTGGGGGAGGGGGGACCAAGG + Intergenic
948813566 2:240498473-240498495 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813578 2:240498508-240498530 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813754 2:240499395-240499417 ATGTGGGGGTGGGGGTGACCAGG + Intronic
948964601 2:241367954-241367976 ATGTGGGGGTGGAGGGTATATGG - Intronic
1168834941 20:871717-871739 CTGGGGGAGTTGAGGTTACAGGG + Exonic
1169016739 20:2298589-2298611 CTTTGGGGGTGGAGGAAATGAGG - Intronic
1169109387 20:3022236-3022258 ATGTGGGGGTGGGGGTACAAGGG - Intronic
1169219017 20:3810489-3810511 CTGTGGGTGGGAAGGTAACGTGG - Intergenic
1170154643 20:13258281-13258303 CTGTGGGGTTGGAAGTAAGGTGG - Intronic
1170741097 20:19057198-19057220 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171370801 20:24660991-24661013 CTGTGGGGGTGCAGCTGCCATGG - Intronic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173654675 20:44691408-44691430 CTGTAGGGGTTGTGTTAACAAGG + Intergenic
1174339067 20:49884705-49884727 GTGTGGGGCTGGAGGTACCCAGG + Intronic
1174507326 20:51024837-51024859 CTGTGGAGGTGATGGTTACATGG + Intergenic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1176293402 21:5058335-5058357 CTGCAGGGGTGGAGGTTGCAGGG - Intergenic
1177460034 21:21397463-21397485 CAGAGGGGGTTGAGGTAGCAGGG + Intronic
1178711507 21:34921292-34921314 CTGTGGGGGAGGGGGAAACAGGG - Intronic
1179727475 21:43348447-43348469 CTCTGGGGCTGGAGGTATCCCGG + Intergenic
1179863858 21:44205313-44205335 CTGCAGGGGTGGAGGTTGCAGGG + Intergenic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1181309287 22:21935346-21935368 CTGTAGGGGTGGGGGTATAAGGG + Intronic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1181862265 22:25828328-25828350 CTGTAGGGGTGGACACAACAGGG - Intronic
1182737713 22:32542945-32542967 CTGTCGGGGTGAGGGTGACAGGG - Intronic
1183545184 22:38451683-38451705 GTTTGGGGGTGGAGGAAGCAGGG - Intronic
1184492016 22:44815242-44815264 GTGTGGGGGAGGAGGGAGCATGG + Intronic
1184615169 22:45633038-45633060 CTGTGGGGGCGGGGGAGACAGGG + Intergenic
1185189374 22:49424673-49424695 TGGTGGGGGTGGAGGTCTCAAGG - Intronic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950902070 3:16506660-16506682 CTGCTTGGGTGGAGTTAACATGG - Intronic
951512702 3:23521882-23521904 CTGGGGGGGTGGGGGGTACACGG - Intronic
952045510 3:29314051-29314073 CTGTGGTGGTGGAGGTATAGGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952700239 3:36320025-36320047 CTGAGGGGGTGGGGCTAGCATGG + Intergenic
954332448 3:49898198-49898220 CTGTGGGGGTGGAACTGAAATGG + Exonic
954660440 3:52224194-52224216 CCGTGGGGCTGGAGCTCACAGGG + Exonic
954700362 3:52447702-52447724 CCGTGGGGGTGGAGGGGGCATGG - Intergenic
956157349 3:66312420-66312442 CTGTGGGGGTGGAGCCTACTGGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959168704 3:102816830-102816852 GTGTGGGGGTAGAGGATACATGG - Intergenic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
961390937 3:126551963-126551985 CAGTGGGGGTGGTGGCATCAGGG + Intronic
961836933 3:129669653-129669675 CTCTGCGTGTGAAGGTAACAAGG + Intronic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
963050806 3:141141461-141141483 CTGGGGGGGTGGAGCCAAGATGG - Intronic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
963280876 3:143383827-143383849 CTGTTGGGGTGGGGGAAGCAAGG + Intronic
964325034 3:155535933-155535955 CTGTTCTGGTGGAGGTAGCAGGG - Intronic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
964607761 3:158575489-158575511 GTTTGGGGGTTGAGGTAAAACGG - Intronic
966227495 3:177613728-177613750 CTGTGTGAATGCAGGTAACAGGG - Intergenic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
967313315 3:188127127-188127149 AGGTGGGGCTGGAGGTGACAGGG - Intergenic
967388099 3:188929816-188929838 CTGTGAGTGTGGGGGTAGCACGG - Intergenic
967451112 3:189624307-189624329 TTATGGGGGTGGGGGTGACAGGG - Intergenic
969746962 4:9080148-9080170 CTCTGGGGCTGGAGGGAGCAGGG - Intergenic
969993045 4:11283854-11283876 CTATGGGGGTGGGGGTCTCATGG - Intergenic
970226570 4:13864544-13864566 GTGTGGGGGTGGGGGATACATGG - Intergenic
972603643 4:40594159-40594181 CAGTGCTGGTGGAGGAAACAGGG - Intronic
972899721 4:43668624-43668646 CTGTTCTGGTGGAGGTAGCAGGG + Intergenic
973920156 4:55675927-55675949 CTGCTCTGGTGGAGGTAACAGGG - Intergenic
975369450 4:73568014-73568036 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
976451814 4:85199396-85199418 CTGTGGTGGTGGTGGATACAGGG - Intergenic
977687181 4:99860270-99860292 TTGTTTGGGTGGAGGTAAGATGG + Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
982630610 4:157824705-157824727 CTGTTCTGGTGGAGGTAGCAGGG - Intergenic
982979569 4:162115592-162115614 CTGTGAAGATGGAGGTTACAAGG - Intronic
984437953 4:179727896-179727918 CTGCAGGGGTGGGGGTCACAAGG - Intergenic
984849461 4:184141426-184141448 CTGTGGGGAAGGCGGCAACAAGG + Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
987403974 5:17506602-17506624 CTGTGGAGGTGGAAGTTAAAGGG - Intergenic
987411445 5:17619350-17619372 CTGTGGAGGTGGAAGTTAAAGGG - Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988974878 5:36505158-36505180 CAGTGGGGGTAAAGGGAACATGG + Intergenic
989164871 5:38424059-38424081 TTCTGGGGGTGGAGGTAGAAGGG - Intronic
990148945 5:52794747-52794769 CTTTGCTGGTGGAGGTCACATGG + Intronic
990582136 5:57174783-57174805 CTGAGGGGGTGGAAGGTACAGGG - Intronic
990899999 5:60739544-60739566 CTGTGGTGGTGGTGGACACAGGG + Intergenic
990992824 5:61701872-61701894 CTCTGGGGGTGGGGGAAACTGGG - Intronic
991237805 5:64419267-64419289 CTGTGGTGGTGGTGGCCACAGGG + Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992511784 5:77443956-77443978 CTTGGGAGGTGGAGGTTACAGGG - Intronic
992955884 5:81907616-81907638 TTCTGGGGCTGGAGGAAACAAGG + Intergenic
994233926 5:97339764-97339786 CTGTGATGGTGGTGGTCACAGGG + Intergenic
994646110 5:102470849-102470871 CTGTTCTGGTGGAGGTAGCAGGG + Intronic
997266444 5:132497690-132497712 CTGTGGGGGAGCAGGTCAGAAGG - Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998142431 5:139707754-139707776 TTGAGGGGGTGGAGGTCACTGGG - Intergenic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
1000159810 5:158586620-158586642 CTGTGGTGGTGGTGGCTACAGGG - Intergenic
1002173497 5:177388211-177388233 GGGTGAGGGTGGGGGTAACAAGG + Intronic
1002312083 5:178320862-178320884 CTGTGGGCCTGGAGGTCGCATGG + Intronic
1002563335 5:180097058-180097080 TTCTGGGGGTGGCAGTAACATGG - Intergenic
1003360540 6:5421051-5421073 CTGTAGGGGTGGAGTTCTCATGG - Intronic
1003912639 6:10756350-10756372 GTGTGGGGGAGGAGGTACTAAGG - Intronic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005985653 6:30872904-30872926 CAGTGTCAGTGGAGGTAACATGG - Intergenic
1007975696 6:46098978-46099000 CTGCGGGGGTGGGGGTAGAAGGG + Intergenic
1008370358 6:50724091-50724113 CCGTGGGGGGAGAGGTAACATGG + Intronic
1010807049 6:80249650-80249672 CTCTTGGGGTGGAGGTAAGAGGG + Intronic
1012847922 6:104413166-104413188 GTCTGGGGGTGGAGGCAGCAAGG - Intergenic
1015644164 6:135368227-135368249 CTGCGCTGGTGGAGGTAGCAGGG + Intronic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016457321 6:144244849-144244871 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1016537271 6:145123015-145123037 CTCTGGAGGTGGAGGTTGCAGGG - Intergenic
1016888670 6:148983877-148983899 ATGTGGGGGTGGTGGTGATAGGG - Intronic
1017113382 6:150953365-150953387 GTGTGGGGGTGGAGGCAGCCGGG - Intronic
1017618569 6:156271559-156271581 CTGTAGGGATGGTGGTATCATGG - Intergenic
1017971363 6:159315247-159315269 CTGTGGGGGTGGGCGCATCACGG + Intergenic
1018055828 6:160051448-160051470 GCTTGAGGGTGGAGGTAACAAGG + Intronic
1018542527 6:164898035-164898057 CTTTGGGGGTGGGGGAAAAAAGG - Intergenic
1019352693 7:562365-562387 CTGTGGAGCTGGAGGCGACAGGG - Intronic
1019384011 7:743429-743451 CTGTAGGCGTGGATTTAACAGGG - Intronic
1019718069 7:2550714-2550736 CTGGGAGGGAGGAGGAAACAGGG + Intronic
1019797337 7:3060781-3060803 CTGTTGGAGTGGATGTAAAATGG - Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020326489 7:6978417-6978439 CTCTGGGGCTGGAGGGAGCAGGG + Intergenic
1020693284 7:11385863-11385885 GTGAGGGGGTGGAGGTAAGGGGG - Intronic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021793379 7:24228299-24228321 CTTTGGGGGTAGGGGTAAAAAGG - Intergenic
1022525464 7:31034291-31034313 CAGTGGGGGTGATGTTAACAAGG + Intergenic
1022741080 7:33122493-33122515 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1024314112 7:47998169-47998191 CTGTGGGTGAGAATGTAACATGG - Intronic
1025111760 7:56223056-56223078 CGGTGGAGGGAGAGGTAACAGGG + Intergenic
1025160312 7:56653708-56653730 CTGTGGGTGTGGCGGTTTCAAGG - Intergenic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1025755227 7:64331984-64332006 CTGTGGGTGTGGTGGTTTCAGGG + Intronic
1027188584 7:75985544-75985566 GTGTGGCGGTGGAGCTCACACGG + Intronic
1028782926 7:94757675-94757697 CTGTTCTGGTGGAGGTAGCAGGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029529781 7:101117616-101117638 GGGTGGGGGTGGAGGTCCCAGGG - Intergenic
1029707825 7:102285053-102285075 CTGTGGGGGTGGAGGGGGCGTGG - Intergenic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030559089 7:111063092-111063114 CTGTAGGGGTGGAGCTCTCATGG - Intronic
1031083379 7:117279325-117279347 CTGTGGGGGAGGAAGTAGAAAGG - Intronic
1031883701 7:127223706-127223728 CCGTGGGAGTGGAGGTCACATGG + Intronic
1032575924 7:133054674-133054696 GGGTGGTGGTGGTGGTAACAAGG - Intronic
1033327566 7:140392214-140392236 CTGGGCTGGTGGAGGTTACACGG - Intronic
1034264037 7:149772886-149772908 CTGTGGGGGTAGAGGAGACCGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037342499 8:17861424-17861446 CTGGGGAGGTGGAGGTTGCAGGG - Intergenic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037904979 8:22710914-22710936 CTGTGGGGGAGAAGGTCCCAGGG + Intergenic
1037974833 8:23201679-23201701 CTATGGGGGTGGAGGCACCATGG + Intronic
1038439694 8:27562753-27562775 CTGAGAGAGTGGAGATAACAAGG - Intergenic
1040932278 8:52747770-52747792 CTGTGGGCGTGGAGGTTGCAGGG - Intergenic
1043475231 8:80599567-80599589 GGGTGGGGGTGGAGGCAGCATGG - Intergenic
1043545177 8:81306985-81307007 CTGTTCTGGTGGAGGTAGCAGGG - Intergenic
1044220418 8:89663371-89663393 CTGTAGGGGTGGAGCTCTCATGG - Intergenic
1045180063 8:99771049-99771071 CTCTAGGGGTGAAGGTAAGAGGG - Intronic
1045561833 8:103271534-103271556 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1045634981 8:104174353-104174375 TTGTTGGGGTGGAGGTTAAATGG + Intronic
1046047413 8:108980773-108980795 CTGTTGGGGGGTAGGGAACAAGG - Intergenic
1047937450 8:129796777-129796799 CTGCTCTGGTGGAGGTAACAGGG + Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049332166 8:142060335-142060357 CTGCGGTGGTGGAGGCAAAATGG + Intergenic
1049756724 8:144314102-144314124 CTGCGGGGGTGGGGGTGTCAAGG - Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051599860 9:18862013-18862035 CAGTGGGGGTGGAGCTACCAGGG - Intronic
1052105558 9:24510397-24510419 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1052319326 9:27150690-27150712 CAGTGGGGGTGCAGGAAGCATGG - Intronic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1053663150 9:40298611-40298633 GTGTGGGGGTGGAAGAAAAAAGG + Intronic
1053664603 9:40308698-40308720 GTGTGGGGGTGGAAGAAAAAAGG + Intronic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053796504 9:41731655-41731677 CTGAAGAGGTGGAGGTAAAAGGG + Intergenic
1053913655 9:42929141-42929163 GTGTGGGGGTGGAAGAAAAAAGG + Intergenic
1054148675 9:61583165-61583187 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1054184910 9:61943714-61943736 CTGAAGAGGTGGAGGTAAAAGGG + Intergenic
1054375274 9:64444835-64444857 GTGTGGGGGTGGAAGAAAAAAGG + Intergenic
1054468436 9:65514322-65514344 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1054520011 9:66067586-66067608 GTGTGGGGGTGGAAGAAAAAAGG - Intergenic
1054521466 9:66077674-66077696 GTGTGGGGGTGGAAGAAAAAAGG - Intergenic
1054653597 9:67644785-67644807 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1054811784 9:69440913-69440935 CTGGGGGGGTGGAGCCAAGATGG - Intronic
1055003014 9:71474785-71474807 TTCTGTGGATGGAGGTAACAAGG + Intergenic
1055137966 9:72844637-72844659 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1055774076 9:79749102-79749124 CAGTGGGGCTGGAATTAACAAGG + Intergenic
1057469161 9:95342409-95342431 CTGGGGGGAAGGAGGTAACTAGG + Intergenic
1058193059 9:101941537-101941559 CTGAGGGGGTGGAGCCAACATGG - Intergenic
1059294041 9:113253884-113253906 CTATGGGGTAGGAGTTAACAAGG + Intronic
1059450922 9:114371017-114371039 CTGGGGGGGAGGTGGCAACATGG + Intronic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1061790911 9:133058356-133058378 CTGTGGTGGTGGAGATAGCGTGG + Exonic
1061912435 9:133732291-133732313 CTGTGAGGGTGGAGGTACGCTGG - Intronic
1061919510 9:133775035-133775057 CTGTAGGTTTGCAGGTAACATGG - Exonic
1187362128 X:18638192-18638214 CTGTGTGGGAGGAGGTTACTTGG - Intronic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1191703796 X:64071242-64071264 CTGTGGTGGTGGTGGCAACAGGG + Intergenic
1194066453 X:89267535-89267557 CGGTGGGGGTGGGGGTTGCATGG + Intergenic
1194095270 X:89631930-89631952 CTGTTCTGGTGGAGGTAGCAGGG + Intergenic
1194259707 X:91678005-91678027 CTGTAGGGGTGGAGTTCTCATGG - Intergenic
1194990753 X:100544131-100544153 CTGTGGGCCTTAAGGTAACATGG + Intergenic
1195474960 X:105275133-105275155 CTCGGGAGGTGGAGGTTACAGGG + Intronic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1197518962 X:127473430-127473452 CTGTTCTGGTGGAGGTGACAGGG - Intergenic
1198596886 X:138245957-138245979 CTGTGGTGGTGGTGGTTACCTGG - Intergenic
1198783531 X:140261783-140261805 CTGAGGGGGTGGAGATATTAAGG + Intergenic
1199191866 X:144980526-144980548 CTGTGCTGGTGGTGGAAACAAGG + Intergenic
1199336946 X:146629437-146629459 CTGTGGCAGTGTAGGAAACATGG + Intergenic
1200578407 Y:4917198-4917220 CTGTAGGGGTGGAGTTCTCATGG - Intergenic
1200720623 Y:6601656-6601678 CGGTGGGGGTGGGGGTTGCATGG + Intergenic