ID: 1028855884

View in Genome Browser
Species Human (GRCh38)
Location 7:95593421-95593443
Sequence CCAATAATGAGATGTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028855884_1028855887 0 Left 1028855884 7:95593421-95593443 CCTCCTACACATCTCATTATTGG 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1028855887 7:95593444-95593466 AGTAAATTTATAGTAAAAATAGG 0: 1
1: 1
2: 6
3: 88
4: 869
1028855884_1028855890 11 Left 1028855884 7:95593421-95593443 CCTCCTACACATCTCATTATTGG 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1028855890 7:95593455-95593477 AGTAAAAATAGGTCTCCCTGGGG No data
1028855884_1028855891 12 Left 1028855884 7:95593421-95593443 CCTCCTACACATCTCATTATTGG 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1028855891 7:95593456-95593478 GTAAAAATAGGTCTCCCTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1028855884_1028855888 9 Left 1028855884 7:95593421-95593443 CCTCCTACACATCTCATTATTGG 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1028855888 7:95593453-95593475 ATAGTAAAAATAGGTCTCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 141
1028855884_1028855889 10 Left 1028855884 7:95593421-95593443 CCTCCTACACATCTCATTATTGG 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1028855889 7:95593454-95593476 TAGTAAAAATAGGTCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028855884 Original CRISPR CCAATAATGAGATGTGTAGG AGG (reversed) Intronic
906521882 1:46471917-46471939 ACAATAATGAGATCTATATGTGG + Intergenic
907712057 1:56892535-56892557 TGACTAATGAGATATGTAGGGGG - Intronic
910104154 1:83612585-83612607 CCAAGAGTGAGATGGGAAGGTGG - Intergenic
912108389 1:106309778-106309800 ACTAAAATCAGATGTGTAGGAGG + Intergenic
912528502 1:110303115-110303137 CCATGAATCAGATGTGGAGGGGG + Intergenic
917341799 1:173987089-173987111 GCAATAATAAGTTGTGTTGGTGG - Intronic
919015264 1:192025268-192025290 CCAGTAATGAGATTTCTGGGTGG + Intergenic
921026848 1:211292273-211292295 CCAAATATGAGATGCGTTGGTGG - Intronic
922997423 1:229975541-229975563 CCAGGAAGGAGATGTGAAGGTGG + Intergenic
1066009636 10:31182544-31182566 GCAAAAATGTGATGTGTAGAGGG - Intergenic
1067957733 10:50810896-50810918 CAAATATTGAGATGTGTAGTTGG - Intronic
1068217556 10:54002670-54002692 CCAATAGTGAGGTGTGGAGTTGG + Intronic
1070938306 10:80319780-80319802 CAAATAATGAAATCTCTAGGAGG + Intergenic
1070945628 10:80389211-80389233 CGAATGAAGAGATGTGTGGGTGG - Intergenic
1072066862 10:91879802-91879824 CCAATAAAGAGCTTTGTATGTGG + Intergenic
1072338281 10:94420077-94420099 CCAGTAATGATATTTGGAGGTGG + Intronic
1073409447 10:103328043-103328065 CCAATAGTTTGAGGTGTAGGAGG + Intronic
1073829090 10:107361169-107361191 CCAATAAAGTGAAGTGTATGGGG + Intergenic
1074475560 10:113770788-113770810 CCAATAATGTTATCTCTAGGGGG - Intronic
1077724645 11:4661723-4661745 CCAATCATGAGAAGAGCAGGCGG + Intergenic
1080199090 11:29647839-29647861 CCAAAAGAGAGATGTGTAAGAGG + Intergenic
1080287966 11:30638616-30638638 CAAATAAAGAGATGTGCAGATGG - Intergenic
1081721338 11:45290963-45290985 CCAAAGGTGAGATGTGCAGGAGG + Intergenic
1086893994 11:92291199-92291221 CCAGTACAAAGATGTGTAGGCGG + Intergenic
1095897093 12:47290593-47290615 CAATGAATGAGATGTGTATGGGG + Intergenic
1095903822 12:47356746-47356768 CCAAAAGTGAGGGGTGTAGGTGG + Intergenic
1096129670 12:49147814-49147836 CCCATAATGAGACGTCCAGGGGG - Intergenic
1096191087 12:49619968-49619990 TCAATAATGAGATGTGGACGCGG - Intronic
1101727496 12:107400291-107400313 CCCATGATGAGATGCTTAGGGGG + Intronic
1107343619 13:39436847-39436869 CCAACAATGGGAGGTGTATGTGG + Intronic
1107360991 13:39617793-39617815 CCATCAATGTGAGGTGTAGGTGG - Intergenic
1111789186 13:92831458-92831480 CAAATATTAAGATGTGTAAGAGG - Intronic
1118063406 14:62165130-62165152 GCAATGATGAGAGGTGTAGGAGG + Intergenic
1124171098 15:27374773-27374795 CCAATAATGAACTGAGTTGGAGG - Intronic
1125051442 15:35302398-35302420 CCAATAATGTGAAGTGCTGGAGG - Intronic
1127198745 15:56619948-56619970 AGAATAATCAGAGGTGTAGGAGG - Intergenic
1144109508 17:12018739-12018761 CCAATAATTAGATGTGCATATGG - Intergenic
1146827593 17:36036756-36036778 CTTATAATAAGATGTGTAGTAGG - Intergenic
1150556113 17:66256048-66256070 ACAATAATAAGATCTGTAGTAGG - Intronic
1152520452 17:80853022-80853044 CCAATACGGAGATGGGGAGGAGG - Intronic
1153825836 18:8874042-8874064 CAAATAATCAGAGGTGGAGGTGG - Intergenic
1155353486 18:24929031-24929053 CCAATTATGTGATGTGGAGTGGG + Intergenic
1155758477 18:29533092-29533114 CCAATAATGGGATTTCTAGGTGG - Intergenic
1156088972 18:33442111-33442133 TCAATAATGAGATTTCTAGTAGG - Intergenic
1158752820 18:60284244-60284266 CCAATAATGACAAATGTATGAGG - Intergenic
1162446741 19:10727940-10727962 CCAATAATGAGATATTTATAGGG + Intronic
1163772027 19:19197066-19197088 CCAACAAGGAGAGGAGTAGGAGG + Intronic
1163810776 19:19430052-19430074 CCAATACTGAGATTTGAAGGGGG - Intronic
1168219481 19:54950236-54950258 CCAAGGAAGAGATGCGTAGGGGG - Intronic
930925192 2:56809575-56809597 CCAATAATTAGATGAGTTTGGGG - Intergenic
931073885 2:58687038-58687060 CCAAGAATGAGAAGTGAAAGAGG - Intergenic
933790356 2:85879226-85879248 CCAACCAAGAGATGTGGAGGAGG + Intronic
936924031 2:117718628-117718650 CCCAAATTGAGATGTGCAGGAGG - Intergenic
937326376 2:120991811-120991833 AGAATGATGACATGTGTAGGTGG + Exonic
937675232 2:124583004-124583026 CCAATAATGAGGTGTCAAGCTGG - Intronic
939299754 2:140320230-140320252 CCAATAAATAGATGTTTATGTGG - Intronic
940641892 2:156353554-156353576 CCAATAATAAGAGTTCTAGGTGG + Intergenic
941327439 2:164134354-164134376 CTAATAATAAGATAGGTAGGTGG + Intergenic
946447769 2:219754497-219754519 CCAAGAATGAGAAGTGTGGCAGG - Intergenic
946539980 2:220673504-220673526 CCAATATTGGCATGTGTATGTGG + Intergenic
947968623 2:234302936-234302958 TTAATAAGGAGATGTTTAGGTGG - Intergenic
1169738112 20:8859361-8859383 CCAAAAATGTGATGTGTATGTGG + Intronic
1170072070 20:12380111-12380133 CCAAGTATAAGATGTGTGGGGGG + Intergenic
1172785887 20:37468592-37468614 AAAATAATGAGATGTTGAGGTGG + Intergenic
1174972817 20:55296190-55296212 CCAAGATTGAGATGAGTGGGTGG + Intergenic
1176777978 21:13156964-13156986 CCAATAATGGTGTGTGTAGATGG - Intergenic
1177806431 21:25879457-25879479 CCAATAATGGGATGTGGAGGTGG + Intergenic
1180607288 22:17068330-17068352 ACAAGAATGTGATGTGTGGGAGG + Intergenic
1181415593 22:22756487-22756509 CCAATAAGGAGCTGTGAAGCTGG - Intronic
1182569186 22:31223489-31223511 AAAATAATGAGATGTGCTGGGGG + Intronic
1182790754 22:32950862-32950884 CCTATAATGAGGGGTGTAGCAGG + Intronic
949549008 3:5096810-5096832 CCAACAATGAGAAGGGTGGGGGG + Intergenic
952917385 3:38257823-38257845 CCACTAATGAGATGTTTACATGG - Intergenic
960460994 3:117935835-117935857 CCAAGCATGAAATGTGCAGGTGG - Intergenic
962111106 3:132449313-132449335 CCATTAATGAGATGTGCTGATGG - Intronic
967527407 3:190510770-190510792 CCAAGAAGGAGATATGAAGGAGG + Intergenic
970436180 4:16037615-16037637 CCAGTAAGCAGATGTATAGGTGG - Intronic
971548030 4:27912062-27912084 CCAATAATGGGTTGTCGAGGTGG - Intergenic
972096673 4:35355532-35355554 CAAATAATAACATGTGTAGTAGG - Intergenic
975648240 4:76566532-76566554 CCATTAAGGATATGTGGAGGGGG - Intronic
978482740 4:109212703-109212725 CCTAAAATGAGATGTATATGAGG + Intronic
979265426 4:118696417-118696439 CCTTTAATGAGATGTTAAGGTGG + Intronic
981531208 4:145755339-145755361 CCTATAAAGAATTGTGTAGGGGG + Intronic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
993760236 5:91785934-91785956 CCAAGAATGATATGAGAAGGGGG + Intergenic
997181254 5:131831595-131831617 CCAAAAATAAAAAGTGTAGGAGG - Intronic
997634420 5:135394432-135394454 CAAATAGAGAGATGTGTTGGAGG - Intronic
1000716452 5:164650691-164650713 CCAAGAATGATAGGTGTAGGAGG - Intergenic
1001078914 5:168652494-168652516 CCAACAAGGTAATGTGTAGGAGG + Intergenic
1003019605 6:2498103-2498125 CTTATAATTAGATGTGTGGGAGG + Intergenic
1004541254 6:16552563-16552585 GCAAAAATTAGAAGTGTAGGTGG + Intronic
1007853254 6:44825911-44825933 CCAACAATGAAATATGTATGCGG + Intronic
1012103861 6:95127911-95127933 CCACTAAGGATATGTGTTGGGGG + Intergenic
1014469119 6:121793389-121793411 CCAACAAGTAGATGTGCAGGAGG + Intergenic
1020290749 7:6720715-6720737 TCAATAATCAGATTGGTAGGAGG - Intergenic
1020428023 7:8091726-8091748 GAAATAATGGGATGTGTATGGGG - Intronic
1021601521 7:22368910-22368932 CCAATCATGAGATGTTTAATGGG + Intergenic
1024358180 7:48439543-48439565 CCAATTATGATATATGCAGGAGG + Intronic
1024612279 7:51077784-51077806 CAGAAAATGAGAAGTGTAGGTGG + Intronic
1028855884 7:95593421-95593443 CCAATAATGAGATGTGTAGGAGG - Intronic
1030310778 7:108067240-108067262 CCAATGATGGGCTGGGTAGGTGG + Intronic
1030569595 7:111206163-111206185 CTAATAGTGAGATCTGAAGGAGG - Intronic
1035517338 8:247144-247166 CCATTGATGAGATGTATAGCTGG + Exonic
1038892832 8:31746112-31746134 ACAATAGTTAAATGTGTAGGAGG + Intronic
1046883372 8:119335061-119335083 CCAATAATGAGATTGCTAGGTGG + Intergenic
1047228998 8:122980066-122980088 CCAAGAATGAGATGAGTGGAGGG - Intergenic
1048538361 8:135318834-135318856 CTAAAAATGAGATGTGAAGAAGG - Intergenic
1050208832 9:3230294-3230316 CTAATAATTACATGTCTAGGAGG - Intronic
1052034805 9:23668510-23668532 CCAACAATGAGAGGTTTAAGTGG + Intergenic
1058537455 9:105976985-105977007 CCACTGATGAGATGTGTCTGAGG - Intergenic
1060827884 9:126696742-126696764 CCAAAAAAGAGATGGGGAGGAGG - Exonic
1187210168 X:17222368-17222390 AGAATAATGATATGTGGAGGTGG + Intergenic
1191636780 X:63386839-63386861 CCAGTCATGAGATATCTAGGTGG - Intergenic
1197538769 X:127727578-127727600 TTAATATTGAGATGTGTAGGAGG + Intergenic
1198468315 X:136922873-136922895 CAAATAAAGAGTTTTGTAGGAGG - Intergenic
1199313179 X:146345421-146345443 ACAATGATGAGATATCTAGGTGG + Intergenic
1199353809 X:146836572-146836594 CCAAGCATGAGATTTGGAGGAGG - Intergenic
1200126255 X:153816312-153816334 CCAACAATCAGGTGTGTTGGGGG + Intronic