ID: 1028859342

View in Genome Browser
Species Human (GRCh38)
Location 7:95630761-95630783
Sequence CAGTGGTTTCTCAGAGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028859340_1028859342 -7 Left 1028859340 7:95630745-95630767 CCAGACAGATTTACTCCAGTGGT No data
Right 1028859342 7:95630761-95630783 CAGTGGTTTCTCAGAGATGCAGG No data
1028859337_1028859342 20 Left 1028859337 7:95630718-95630740 CCTGCTCTTATTACAGTCGAATG No data
Right 1028859342 7:95630761-95630783 CAGTGGTTTCTCAGAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028859342 Original CRISPR CAGTGGTTTCTCAGAGATGC AGG Intergenic
No off target data available for this crispr