ID: 1028862973

View in Genome Browser
Species Human (GRCh38)
Location 7:95675402-95675424
Sequence GCAGAGTCAAGGAGCTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028862973_1028862976 25 Left 1028862973 7:95675402-95675424 CCACTCAAGCTCCTTGACTCTGC No data
Right 1028862976 7:95675450-95675472 TCTCACTGACCGTCCAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028862973 Original CRISPR GCAGAGTCAAGGAGCTTGAG TGG (reversed) Intergenic
No off target data available for this crispr