ID: 1028868289

View in Genome Browser
Species Human (GRCh38)
Location 7:95737892-95737914
Sequence ACTCTCCCTAATTGCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028868284_1028868289 27 Left 1028868284 7:95737842-95737864 CCAAAGCCATAATTGTGGAAAGC No data
Right 1028868289 7:95737892-95737914 ACTCTCCCTAATTGCAAGCCTGG No data
1028868285_1028868289 21 Left 1028868285 7:95737848-95737870 CCATAATTGTGGAAAGCACCTTA No data
Right 1028868289 7:95737892-95737914 ACTCTCCCTAATTGCAAGCCTGG No data
1028868288_1028868289 3 Left 1028868288 7:95737866-95737888 CCTTAGCAGTATGGCTGGAATTG No data
Right 1028868289 7:95737892-95737914 ACTCTCCCTAATTGCAAGCCTGG No data
1028868283_1028868289 30 Left 1028868283 7:95737839-95737861 CCTCCAAAGCCATAATTGTGGAA No data
Right 1028868289 7:95737892-95737914 ACTCTCCCTAATTGCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028868289 Original CRISPR ACTCTCCCTAATTGCAAGCC TGG Intergenic
No off target data available for this crispr